Homopolymer tailing Sticky end ligation Blunt end ligation Introduction into host cell ... Microsoft PowerPoint - recombinant DNA Technology.ppt [Comp...
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Eastern Campus Primary Source for
Genetic Engineering / Recombinant DNA technology Genetic engineering is a broad term referring to manipulation of an organisms’ nucleic acid
Chapter 8 Recombinant DNA technology and molecular cloning Sometimes a good idea comes to you when you are not looking for it. Through an improbable combination
DNA (DNA = deoxyribonucleic acid) • DNA is the genetic material of all living cells and of many viruses. • DNA is: an alpha double helix of two polynucleotide
DNA DNA (deoxyribonucleic acid) atau asam deoksiribosa nukleat (ADN) merupakan tempat penyimpanan informasi genetik. Struktur DNA Pada tahun 1953, Frances Crick
REVIEW ARTICLE. DNA Methylation. By Rakesh Singal and Gordon D. Ginder. SINCE ITS FIRST recognition in 1948, the fifth base of human DNA, 5- methylcytosine (5-mC) has generated .... tion factors, including AP-2, c-Myc/Myn, the cyclic AMP- dependent .
Download Why study DNA replication ? Materi genetis : perlu diketahui untuk melihat pewarisan sifat. Replikasi materi genetis : perlu diketahui untuk mengetahui cara materi tersebut diperbanyak dan diwariskan dari satu sel ke sel berikutnya dan
Download daun, daging buah, serangga, kalus, akar batang, daging dan sisik ikan. ... adanya aktivitas enzim endonuklease, karena itu digunakan buffer ekstraksi yang.
1! Since many mutations are deleterious, DNA repair systems are vital to the survival of all organisms ÐLiving cells contain several DNA repair systems that can fix
LINKERS AND ADAPTORS. • short synthetic ... Terminal transferase. dGTP. dCTP. Mix and anneal. Cloning using homopolymer tailing. Use DNA pol Ito fill unequal. Homopoymer ends. HOMOPOLYMER TAILING. Dr.Sarookhani .... and the viral genome is injected t
Download (DNA rekombinan), memasukkan DNA rekombinan ke dalam sel organisme prokariot maupun ... kromosom bakteri sehingga terbentuk kromosom rekombinan.
Download 2 Apr 2015 ... EKSISTENSI TES DNA (Deoxyribo Nucleic Acid) ... Kedudukan alat bukti tes DNA sebagai alat ... DNA sering digunakan oleh tim forensik untuk.
Download hasila pembelahan mengandung DNA penuh dan identik seperti induknya. Dengan demikian, DNA harus secara tepat direplikasi sebelum pembelahan dimulai.Replikasi DNA dapat terjadi dengan adanya sintesis rantai nukleotida baru dari rantai nu
Download Fragmentasi DNA Spermatozoa: Penyebab, Deteksi, dan Implikasinya pada Infertilitas Laki-Laki. Silvia W Lestari,1 Triyana Sari2. 1Departemen Biologi Medik Fakultas Kedokteran Universitas Indonesia. 2Departemen Biologi Medik Fakultas Ked
Download Fragmentasi DNA Spermatozoa: Penyebab, Deteksi, dan Implikasinya pada Infertilitas Laki-Laki. Silvia W Lestari,1 Triyana Sari2. 1Departemen Biologi Medik Fakultas Kedokteran Universitas Indonesia. 2Departemen Biologi Medik Fakultas Ked
DNA results tainted Andy Nelesen Green ... evidence that directly connects Halbach to Steven Avery's property. Avery, ... death and is scheduled for trial in April
Download Fragmentasi DNA Spermatozoa: Penyebab, Deteksi, dan Implikasinya pada Infertilitas Laki-Laki. Silvia W Lestari,1 Triyana Sari2. 1Departemen Biologi Medik Fakultas Kedokteran Universitas Indonesia. 2Departemen Biologi Medik Fakultas Ked
Download Kedua sumber DNA dipotong menggunakan enzim restriksi EcoRI. Sel kompeten disiapkan dengan CaCl2, transformasi menggunakan metoda kejutan panas.
Download 3. Manipulasi urutan DNA a. Pemotongan- Enzim Restriksi b. Penggabungan- DNA ligasi. 4. Transformasi ke bakteri. 5. Seleksi bakteri rekombinan ...
Download isolasi DNA tanaman cabai berdasarkan kualitas dan kuantitas daun sebagai bahan dasar serta teknik penggerusan. Isolasi DNA dilakukan menggunakan kit ... Benih tanaman cabai dibawa masuk ke. Indonesia oleh para pedagang .... Ekstraksi
Download Penelitian transformasi fragmen DNA Xanthomonas campestris ke dalam Escherichia coliDH5αα, digunakan vektor plasmid. Escherichia coli (pUC19). DNA kromosom diisolasi dengan metoda CTAB. DNA plasmid diisolasi dengan metoda alkali lisis.
Maryland’s statute, at issue in King, requires that DNA samples be collected from individuals charged with burglary or a crime of violence and provides that the
MACHEREY-NAGEL – 10/2017, Rev. 08 3 Endotoxin-free plasmid DNA purification Table of contents 1 Components 4 1.1 Kit contents 4 1.2 Reagents and equipment to be
Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists i i namedd Boyer andd Cohen h in i 1973.
Majid Mojarrad
Recombinant DNA
Fig. 1.2 Many scientific disciplines contribute to molecular biotechnology, which generates a wide range of commercial products
Formed when two genes from two different sources often different species are combined in vitro into the same molecule This pprocess is called ggenetic engineering g g Lead to a new field called biotechnology, the manipulation of organisms or their components to make useful products
DNA cloning gene cloning - prepare multiple identical copies of gene-sized pieces of DNA.
Generation of DNA fragment
Joining into a vector or carrier molecule
Introduction into host cell to amplification
Selection of required sequences
١
١۴٣٠/١٢/٠۴
Genes can be cloned into recombinant DNA vectors
Five steps:
Isolation of vector and gene Insert gene into vector Transform bacteria with vector Plate bacteria under selection Identify clones carrying vector
Generation of DNA fragment
Joining into a vector
Introduction into host cell
Mechanical shearing
Blunt end ligation
Transformation with recombinant plasmid
Restriction enzymatic digestion
Sticky end ligation
Direct chemical synthesis
Homopolymer tailing
PCR
Use of linker
RT-PCR
Enzymatic digestion of purified DNA PCR RT-PCR
٢
Transformation Electroporation Conjugation
symmetrical series of four to eight bases Sticky or blunt ends Restriction fragments-specific for each DNA
Origin – bacteria
in vitro
Cut DNA at specific DNA sequences
Methods of Introducing Foreign DNA
Packaging DNA
Restriction enzymes are used to make recombinant DNA
Generation of DNA fragment
Ligase independent cloning
Transfection with recombinant phage
How do they protect their own DNA?
Combined by DNA ligase
How can you identify which clones carry the vector? 1) Nucleic acid hybridization 2) Isolation of plasmid DNA from individual clones and restriction mapping PCR
١۴٣٠/١٢/٠۴
PCR: History PCR Invention: 1987 Kary Mullis PCR is essentially DNA replication in a tube.
Series of repetitive steps enabling amplification of target DNA from a complex mixture of DNA
The major advantages of PCR
Speed and ease of use
30 cycles each taking 3-5 mins
Sensitivity
Need for Target DNA sequence information
Can amplify from a single cell, cell great care must be taken to avoid contamination
There is an upper pp limit to the size of DNA synthesized y byy PCR
Infidelity of replication
Will even work on degraded DNA or fixed DNA
To construct primers you need to know your target
Short size limit for product
Robustness
Disadvantages of PCR
Because the PCR polymerases are heat stable they ten not to have the 3’->5’ exonuclease activity
Template Plasmid cDNA (RT (RT--PCR) Genomic DNA
P
C
Plasmid
P
Purified (P) Crude Lysate (C)
C
Genomic
40ng 10ng 1ng
٣
١۴٣٠/١٢/٠۴
dNTPs
Buffer All 10x 10x Buffers are not the same
Mixture of dATP dATP,, dCTP, dCTP, dGTP, dGTP, dTTP or dUTP Purity-- chemical or enzymatic synthesis Purity Stability-- concentration – Li or Na salt form Stability
Avoid di di--nucleotide repeats that occur consecutively consecutively-ATATATAT
Match Tm of primers
Tm oC= 2(A/T) + 4(G/C)
3’ Stability
GG or GC clamps
Avoid long runs of single basesbases- ACGGGGGGAT
Avoid crosscross-homologyhomology- BLAST Test
١۴٣٠/١٢/٠۴
Primer Variation Example PCR 1st Round vary primer pairs Sets A-F A= Primer 1F B= Primer 2F C= Primer 3F D= Primer 1F D E= Primer 2F F= Primer 3F Forward primers Primer 1: GAGGGCAGATTCGGGAATG Primer 2: TCGGGAGAGGCCCTTCCC Primer 3: CAGTTTCCCGGGTTCGGC
Primer 1R Primer 1R Primer 1R Primer 2R Primer 2R Primer 2R
DNA Taq Polymerases Considerations: Aim of experiment
Thermal stability Processivity Fidelity
Tm=600c Tm=620c Tm=600c
Reverse primers Primer 1: AGCCTAATCAAGTCACTATCAAG Primer 2: GCAAGTGAGAAAATGGGGAG
Tm=620C Tm=600C
DNA Taq Polymerases Standard polymerase Standard polymerase with loading dye Hot Start polymerase
works for most applications
Polymerase blends or cocktails
combine polymerases for fidelity with speed
aids in higher throughthrough-put inhibits non non--specific primer extension
http://www.firstmarket.com/cutter/cut2.html http://frodo wi mit edu/primer3/ http://frodo.wi.mit.edu/primer3/ http://www.ncbi.nlm.nih.gov/tools/primerblast/index.cgi?LINK_LOC=BlastHome
Introducing of restriction sites
Cloning of PCR products
PCR cycle
transformation Plasmid digestion PCR product digestion Measurement of molar concentration of DNA htt // http://www.basic.northwestern.edu/biotools/olig b i th t d /bi t l / li ocalc.html Ligation transformation
٨
Heat shock electroporation
١۴٣٠/١٢/٠۴
٩
Preparing medium Antibiotic selection Liquid culture Pl Plasmid id extraction t ti Plasmid identity confirmation Sequencing subcloning