JOURNAL OF CELL SCIENCE ACCEPTED MANUSCRIPT

© 2014. Published by The Company of Biologists Ltd.

A Novel Myomegalin Isoform Functions in Golgi Microtubule Organization and ERGolgi Transport Zhe Wang, Chao Zhang, and Robert Z. Qi* Division of Life Science and State Key Laboratory of Molecular Neuroscience, The Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong, China

Journal of Cell Science

Accepted manuscript

*Author for correspondence ([email protected])

1

JCS Advance Online Article. Posted on 12 September 2014

ABSTRACT The Golgi apparatus of mammalian cells is known to be a major microtubule-organizing site that requires microtubules for its organization and protein trafficking. However, the mechanisms underlying the microtubule organization of the Golgi apparatus remain obscure. We used immunoprecipitation coupled with mass spectrometry to identify a widely expressed isoform of the poorly characterized muscle protein myomegalin. This novel isoform, myomegalin variant 8 (MMG8), localized predominantly to cis-Golgi networks by interacting with AKAP450, and this interaction with AKAP450 was required for the stability of both

Accepted manuscript

fragmentation. Furthermore, MMG8 associated with -tubulin complexes and with the


proteins. Disrupting MMG8 expression affected ER-to-Golgi trafficking and caused Golgi

Keywords: Golgi apparatus, microtubule, myomegalin, protein trafficking

microtubule plus-end tracking protein EB1, and MMG8 was required for the Golgi localization of these 2 molecules. On the Golgi, -tubulin complexes mediated microtubule nucleation, whereas EB1 functioned in ER-to-Golgi trafficking. These results indicate that MMG8 participates in Golgi microtubule organization and thereby plays a crucial role in the organization and function of the Golgi apparatus.

2

INTRODUCTION The Golgi apparatus (GA) is a membranous organelle that plays a pivotal role in protein posttranslational modification, sorting, and transport. The assembly, positioning, and function of the GA require an intact microtubule cytoskeleton (Lippincott-Schwartz, 1998; Rios and Bornens, 2003; Sutterlin and Colanzi, 2010). In interphase animal cells, the GA exhibits a crescent moon-shaped, ribbon-like morphology in the perinuclear region that typically surrounds the centrosome. When cells divide, the GA undergoes fragmentation and then reassembles during the late stages of mitosis. During reassembly, microtubules derived from


Accepted manuscript

the GA and centrosomes enable the GA to form a continuous ribbon structure featuring Golgi ministacks positioned near the center of cells (Miller et al., 2009). In the secretory pathway used by cells, proteins are transported from the endoplasmic reticulum (ER) to the GA, where they are eventually sorted into post-Golgi carriers. The ER-to-Golgi transport of proteins is initiated by the packaging of cargo into COPII-coated vesicles at ER-exit sites and it is followed by the formation of ER-Golgi cargo carriers that associate with dynein-dynactin to move along microtubules toward the GA (Presley et al., 1997; Scales et al., 1997; Watson et al., 2005). The GA serves as a major microtubule-organizing center (Chabin-Brion et al., 2001; Efimov et al., 2007; Miller et al., 2009; Rivero et al., 2009). For example, almost half of all cellular microtubules originate from the GA in human retinal pigment epithelial RPE1 cells (Efimov et al., 2007). Moreover, microtubule nucleation at the GA does not require centrosomes and it depends instead on -tubulin (Efimov et al., 2007), the principal microtubule nucleator in cells that exists in the form of -tubulin complexes (TuCs). The cisGolgi proteins AKAP450 (also known as AKAP350, CG-NAP, and hyperion) and GMAP210 have been proposed to be involved in γ-tubulin recruitment to the GA and thus in the Golgiassociated nucleation of microtubules (Rios et al., 2004; Rivero et al., 2009; Vinogradova et al., 2012). Microtubules originating from the GA are required for Golgi ribbon assembly, directional trafficking, and cell motility (Miller et al., 2009; Rivero et al., 2009). The growing tips of microtubules accumulate a diverse group of proteins called plusend tracking proteins (+TIPs) (Akhmanova and Steinmetz, 2008). To track microtubule plusends, almost all +TIPs must interact with the EB proteins, among which EB1 and EB3 3

display similar tip-tracking properties, whereas EB2 appears to be distinct from the other 2 proteins and, relative to them, exhibits considerably weaker tip-tracking activity (Komarova et al., 2009). In one class of +TIPs, an SxIP motif surrounded by basic and serine-rich sequences is present that is required for the interaction of these +TIPs with the EBH domain of EB1 (Honnappa et al., 2009). EB1, the prototypic member of the EB family, is detected at all growing microtubule tips, and the +TIPs that are localized in association with EB1 at the microtubule plus-ends perform diverse functions, including regulating microtubule dynamics and microtubule attachment to subcellular targets (Akhmanova and Steinmetz, 2008). Although microtubules associate with the GA, whether EB1 and other EB proteins localize


Accepted manuscript

and function at the GA remains unknown. In a yeast two-hybrid screen, myomegalin (myomegalin isoform 1, MMG1; GenBank accession: NP_055459) was cloned as a protein that interacted with cyclic nucleotide phosphodiesterase 4D and thus was referred to as a phosphodiesterase 4D-interacting protein (Verde et al., 2001). The mmg1 sequence encodes an approximately 230 kDa protein that is expressed in heart and skeletal muscles. In GenBank databases, MMG1 is the only protein present that is a homolog of CDK5RAP2, a human microcephaly related protein that is involved in microtubule organization on centrosomes and in microtubule regulation at growing microtubule tips (Choi et al., 2010; Fong et al., 2008; Fong et al., 2009). Here, we report that a novel, nonmuscle MMG isoform, MMG8, functions in Golgi microtubule organization and ER-to-Golgi trafficking. Our results reveal that MMG8 is a widely expressed protein that targets to the cis-side of the GA by interacting with AKAP450. On the GA, MMG8 is involved in recruiting TuCs to promote microtubule nucleation and also in tethering EB1 to enable microtubule-tip capture and efficient ER-to-Golgi trafficking. Therefore, MMG8 plays a key role in Golgi microtubule organization, which is required for efficient ER-to-Golgi trafficking and Golgi organization.

4

RESULTS Identification of MMG8 To detect MMG proteins in proliferating cell cultures, RT-PCR was performed using oligonucleotide primers targeting the human mmg1 sequence encoding amino acids 474–762, a region present in other large MMG variants found in gene databases. This MMG sequence was specifically amplified from the total RNA extracted from HeLa cells (supplementary material Fig. S1A), and the amplified product was verified through sequencing. To generate

Accepted manuscript

and the recombinant protein purified from bacteria was used for immunizing rabbits. The


an antibody against this sequence, the RT-PCR product was cloned for expression in bacteria,

accession: NP_001002811), and the last 4 peptides matched sequences encoded by the cDNA

resulting antibody, designated as 443M, detected a single band of ~150 kDa, which is substantially smaller than the expected size of MMG1 (Verde et al., 2001), in HeLa extracts (Fig. 1A). To identify this protein band, we immunoprecipitated the protein from HeLa cells and excised the band from gels to perform mass-spectrometric analysis (Fig. 1B). Tandem mass spectrometry revealed a total of 13 peptide sequences (supplementary material Fig. S1B). Most of the peptide sequences matched the sequences from MMG variant 5 (GenBank sequence hCG1755149 (Fig. 1C). Specifically, Peptide 13 extended from the last 9 residues shared by NP_001002811 and hCG1755149 to the sequence unique to hCG1755149. Based on the protein-sequencing data, we cloned a novel MMG isoform, designated as MMG8; we have deposited this protein’s sequence in GenBank under the accession number HQ333476. The coding sequence of MMG8 consists of exons 11–26 and the alternatively spliced exon 27 of the human mmg. Because of the alternative splicing of exon 27, MMG8 possesses a unique carboxy-terminus among the MMG isoforms. MMG8 encodes a protein of 1,116 amino acids that contains the region 637–925 corresponding to the RTPCR product, and homologs of MMG8 were detected in Pongo abelii (GenBank accession: NP_001126198) and mouse (GenBank accession: NP_835181) that exhibited overall sequence homologies of 98% and 92%, respectively. MMG8 homologs were also found in Gallus gallus, Xenopus tropicalis, and Danio rerio. The structural features of MMG8 predicted based on sequence analysis include coiled-coil domains and an EB1-binding SxIP motif (supplementary material Fig. S1C). A second antibody, 532C, was generated against 5

the carboxy-terminus of MMG8. The 443M and 532C antibodies yielded identical results; unless specified otherwise, the results shown below were obtained using 532C. MMG8 was detected as a single protein band in immunoblots of extracts of proliferating epithelial cells, fibroblasts, and neuroblastoma cells (supplementary material Fig. S1D). In C2C12 myotubes, 2 lower protein bands were detected in addition to the ~150kDa species (supplementary material Fig. S1D), suggesting the existence of smaller isoforms or proteolytic products. However, MMG1 was not detected in any of these cell cultures (supplementary material Fig. S1D), although it was recognized by the 443M antibody in rat

Accepted manuscript

HeLa cells with the MMG8 antibody. MMG8 staining was highly enriched in the GA, and a


heart tissue extracts. To determine the subcellular localization of MMG8, we immunostained

MMG8 functions in Golgi organization and ER-to-Golgi trafficking

weak, general staining was detected in the cytoplasm (Fig. 1D). Moreover, the distribution of the MMG8 signal on the GA was similar to that of the cis-Golgi protein GM130, but it did not merge with the staining of the trans-Golgi element TGN46 (Fig. 1D), suggesting that MMG8 resides on the cis-side of the GA. During cytokinesis, MMG8 appeared in both Golgi twins (Fig. 1D).

To investigate the function of MMG8, we used RNAi to suppress MMG8 expression. Two siRNA oligonucleotides were designed to target mmg8, and the transfection of either siRNA into cells effectively depleted the protein (~85% reduction, Fig. 2A). Cells transfected with mmg8-targeting siRNAs exhibited a weak background in which Golgi patterns were not detected when cells were labeled with the anti-MMG8 antibody (Fig. 2B), which confirmed the specificity of anti-MMG8 staining. In these cells, the Golgi ribbons were broken into patches that overlapped largely with nuclei (Fig. 2B). This Golgi fragmentation could be rescued by the ectopic expression of MMG8 at low levels (Fig. 2B). We also determined that the overexpression of MMG8 affected Golgi structures: when transiently expressed at low levels, MMG8 exhibited a Golgi pattern of distribution, whereas it caused Golgi fragmentation and cytotoxicity even when expressed at moderately high levels (supplementary material Fig. S2). Together, these results showed that altering MMG8 expression perturbs Golgi organization, and thus the results indicate a critical role of MMG8 in maintaining the structural integrity of the GA. 6

Next, to test whether MMG8 functions in ER-to-Golgi trafficking, we used the wellcharacterized cargo VSVG (vesicular stomatitis virus ts045 glycoprotein). At 40°C, VSVG is reversibly misfolded and thus accumulated in the ER; however, shifting cells to 32°C allows the protein to fold correctly, which results in its export from the ER and subsequent transport along microtubules to the GA (Presley et al., 1997; Scales et al., 1997). When delivered to the medial GA, oligosaccharides linked to VSVG cannot be cleaved by endoglycosidase H (Endo H). In control cells, a substantial amount of VSVG became Endo-H resistant after 40 min at 32°C, and approximately half the total VSVG became resistant after 60 min (Fig. 2C). Disrupting MMG8 expression did not affect the expression and ER accumulation of VSVG at

Accepted manuscript

resistance (Fig. 2C), which indicates a role of MMG8 in the delivery of VSVG to the GA.


40°C (Fig. 2C,D). However, MMG8 depletion markedly delayed the acquisition of Endo-H

the form of puncta and ER-like networks (Fig. 2D). Nocodazole-induced microtubule

To corroborate these findings, we examined the distribution patterns of VSVG. The protein expressed at 40°C was effectively retained in the ER (Fig. 2D). By 40 min after shifting to 32°C, VSVG was predominantly localized at the GA in control cells (Fig. 2D). By contrast, VSVG displayed a mixed distribution in MMG8-depleted cells, with a small amount being present at the GA and a large amount of the protein being dispersed in the cytoplasm in depolymerization fragments the GA into functional stacks, which localize at ER-exit sites (Cole et al., 1996). When the trafficking assay was performed using nocodazole-treated cells, the ER-to-Golgi transport of VSVG was unaffected by the silencing of MMG8 expression (Fig. 2E,F). Collectively, these results indicate that MMG8 is involved in the ER-to-Golgi trafficking that occurs in a microtubule-dependent manner. Association of MMG8 with AKAP450 To gain mechanistic insights into MMG8 function, we sought to identify proteins that bind to MMG8. In large-scale immunoprecipitates of MMG8, the regulatory subunit of protein kinase A (PKA) and EB1 were identified through mass spectrometry. Because AKAP450 is a cis-Golgi protein that anchors PKA (Keryer et al., 1993; Rivero et al., 2009; Schmidt et al., 1999; Takahashi et al., 1999; Witczak et al., 1999), we tested the potential association of MMG8 with AKAP450. Reciprocal immunoprecipitation experiments showed that MMG8 and AKAP450 were coimmunoprecipitated specifically and proportionally (Fig. 3A); quantification of the coimmunoprecipitated AKAP450 and MMG8 in SDS-PAGE gels 7

stained with a fluorescent dye (Fig. 3B) showed that the molar ratio of AKAP450 to MMG8 was 0.98 ± 0.1 to 1. Therefore, MMG8 and AKAP450 formed a stoichiometric complex in the cell extracts. To map the AKAP450-binding site, various MMG8 fragments were ectopically expressed and their coimmunoprecipitation with AKAP450 was tested. The head region of MMG8 comprising amino acids 1–389 was sufficient for binding to AKAP450, whereas the MMG8 fragment comprising amino acids 389–1116 did not bind to AKAP450 (Fig. 3C); moreover, the deletion of amino acids 1–389 strongly impaired MMG8’s AKAP450-binding


Accepted manuscript

activity (Fig. 3C). Next, we performed double-immunostaining of MMG8 and AKAP450 and verified their prominent colocalization at the GA (Fig. 3D). Even after the GA was dispersed by treating cells with brefeldin-A or nocodazole, MMG8 was colocalized with AKAP450 on Golgi fragments (supplementary material Fig. S3). We also examined the subcellular distribution of the AKAP450-binding and binding-deficient fragments of MMG8. When expressed at low levels, the fragment 1–389 localized specifically at the GA (Fig. 3E); by contrast, the expressed 389–1116 fragment did not display any specific distribution pattern (Fig. 3E). These results showed that the 1–389 sequence serves as the AKAP450-binding and Golgi-targeting domain of MMG8. To test whether MMG8 and AKAP450 require each other for Golgi localization, we used RNAi to deplete the proteins one at a time and then checked the Golgi localization of the other protein. Cells depleted of MMG8 or AKAP450 were treated with the proteasome inhibitor MG132 to prevent the degradation of the nontargeted protein (see Fig. 4). MMG8 depletion did not markedly affect the Golgi localization of AKAP450, whereas AKAP450 depletion inhibited MMG8 localization to the GA (Fig. 3F). Collectively, these results indicated that MMG8 is targeted to the GA through its binding to AKAP450 and that AKAP450 localizes to the GA through MMG8-independent mechanisms. In the RNAi experiments performed on MMG8 and AKAP450, we used immunoblotting to probe the levels of both proteins. Notably, suppressing MMG8 expression led to a proportional reduction in the protein level of AKAP450 and vice versa (Fig. 4A), revealing that the expression of each protein depends on the expression of the other. MG132 was applied next to test whether the proteins were degraded through the proteasomedependent pathway. In cells depleted of either MMG8 or AKAP450, the level of the other 8

protein increased over the time course of MG132 treatment and eventually approached the level in control cells (Fig. 4B). In control-transfected cells, the levels of MMG8 and AKAP450 were not markedly altered following MG132 treatment (Fig. 4B). Thus, in the absence of one of the proteins, the other protein becomes unstable and is degraded by the proteasome. MMG8 functions in Golgi-based microtubule nucleation Because AKAP450 is required for microtubule nucleation at the GA (Rivero et al., 2009), we

Accepted manuscript

explored the potential involvement of MMG8 in microtubule nucleation. Anti-MMG8 immunoprecipitation coprecipitated -tubulin and GCP2, which are TuC core components that we examined (Fig. 5A). In the reciprocal experiment, MMG8 was specifically coprecipitated with GCP3, another core component of TuCs (Fig. 5B). To test whether MMG8 can bind to TuCs in the absence of AKAP450, MMG8 was ectopically expressed in cells and immunoprecipitated in RIPA buffer, in which MMG8 was dissociated from AKAP450 and TuCs (supplementary material Fig. S4). The immunoprecipitated MMG8


was used in a pull-down assay performed with extracts of control and AKAP450-depleted cells. In both extracts, MMG8 showed similar binding activity toward TuCs (Fig. 5C), whereas the control MMG8 fragment, 389–1116, did not show any TuC-binding activity (Fig. 5C). Therefore, we conclude that MMG8 can associate with TuCs independently of AKAP450 and that the 1–389 sequence of MMG8 is indispensable for its binding with TuCs. To examine whether the Golgi localization of TuCs requires MMG8, we used RNAi to silence MMG8 expression. To date, the staining of endogenous -tubulin at the GA has only been observed using an antibody that recognizes multiple epitopes of -tubulin (Rios et al., 2004). We considered the possibility that -tubulin is present at the GA at such low levels that it cannot be readily detected above background cytosolic staining. Therefore, we tackled this problem by extracting the cytosol before fixation and also by enhancing the staining signal by using tandem secondary antibodies. In cells extracted with a saponin-containing buffer, labeling for MMG8 and GM130 showed that the GA was largely intact. -Tubulin was readily observed at the GA in addition to being detected at the centrosomes, and tubulin colocalized with MMG8 at the GA (Fig. 5D). MMG8 did not display prominent 9

centrosomal localization in a large population of cells, and RNAi-mediated depletion of MMG8 eliminated the Golgi attachment of -tubulin without discernibly affecting the centrosomal staining of -tubulin (Fig. 5E). Moreover, the detachment of -tubulin from the Golgi membranes was correlated with the removal of Golgi-associated MMG8 (Fig. 5F). These results indicate that MMG8 is required for the Golgi localization of TuCs but is dispensable for the centrosomal attachment of TuCs. To investigate whether MMG8 functions in microtubule nucleation, microtubule

Accepted manuscript

regrowth was performed in RPE1 cells after cold-induced microtubule depolymerization. Before the assays, the cells were transfected with either a control or an mmg8-targeting siRNA. In cold-treated control cells, short microtubules appeared at the GA and as a centrosomal aster after the cells were rewarmed for 1 min (Fig. 6A). At 2.5 min of rewarming, prominent microtubule filaments were observed to emanate from the GA and also from the centrosomes (Fig. 6A). By contrast, the MMG8-depleted cells did not exhibit microtubule growth from the GA even after 2.5 min of rewarming; the centrosomal regrowth was not affected by MMG8 depletion (Fig. 6A). Thus, MMG8 depletion inhibits microtubule


nucleation at the GA but does not affect centrosomal nucleation. Similar results were obtained using nocodazole-treated RPE1 cells, which showed that Golgi ministacks were dispersed in the cytoplasm. Following nocodazole washout, microtubules grew from the ministacks that were costained for MMG8 in the control cells; however, the microtubules failed to grow from the ministacks in the MMG8-depleted cells (Fig. 6B). In RPE1 cells, microtubules emanated from the GA and centrosomes and were distributed in a radial pattern, and the Golgi region harbored a high density of microtubules (Fig. 6C). Suppressing MMG8 expression substantially reduced the microtubule density at the GA (Fig. 6C) and the microtubules did not radiate from the Golgi region (Fig. 6C). These data further supported the conclusion that MMG8 is required for microtubule growth and organization at the GA. Association of MMG8 with EB1/EB3 Mass spectrometry revealed that the immunoprecipitates of MMG8 contained EB1 in addition to PKA. The coimmunoprecipitation of EB1 with MMG8 was verified by means of 10

anti-EB1 immunoblotting (Fig. 7A). MMG8 contains a putative SxIP motif within its 298– 329 sequence region and this motif is conserved in the Pongo abelii and mouse counterparts of MMG8 (Fig. 7B). We constructed an MMG8 mutant in which 2 crucial residues of the SxIP motif, Leu311 and Pro312, were changed to alanines. In striking contrast to wild-type MMG8, the L311A/P312A mutant exhibited no binding activity toward EB1 and EB3 (Fig. 7C,D). Notably, these substitutions did not affect the binding of MMG8 with AKAP450. In RPE1 cells, EB1 was immunostained throughout the GA, in addition to being detected as microtubule tip-tracking speckles (Fig. 7E). Inhibiting MMG8 expression


Accepted manuscript

eliminated the Golgi pattern of EB1, but it did not markedly affect the tip-tracking behavior of EB1 (Fig. 7E). To visualize the Golgi localization of EB1 clearly, cells were extracted with a buffer containing saponin to remove cytosolic proteins but preserve Golgi networks. In the extracted cells, EB1 clearly localized at the GA in an MMG8-dependent manner (Fig. 7F). Similar results were obtained using cells treated with nocodazole, which induced Golgi fragmentation (Fig. 7G). Golgi-associated EB1 functions in ER-to-Golgi trafficking EB1 might depend on its interaction with MMG8 for attachment to the GA. To test this possibility, we expressed the EB1-binding-deficient mutant MMG8(L311A/P312A) and the wild-type protein in cells. The cells that expressed the proteins at moderate levels and did not exhibit clear changes in Golgi morphology were selected for analysis. Both the wild-type and the mutant protein showed prominent localization at the GA, and the transfections did not markedly affect the microtubule tip-tracking of EB1 (Fig. 8A). The Golgi localization of EB1 was substantially diminished or even eliminated in cells transfected with the mutant protein, as compared with the EB1 localization in the wild-type MMG8-transfected cells (Fig. 8A). By contrast, the Golgi localization of AKAP450 and -tubulin was not markedly affected by the expression of the mutant (Fig. 8A). Therefore, the expression of the MMG8 mutant detached EB1 specifically from the GA. To test the function of Golgi-associated EB1, we performed the trafficking assays by using cells that were transfected with the MMG8 constructs. At 15 min after shifting to 32°C, the majority of VSVG was localized to the GA in cells expressing wild-type MMG8, but VSVG was still dispersed in the cytoplasm of cells expressing the EB1-binding-deficient mutant (Fig. 8B). Consequently, VSVG acquired Endo11

H resistance more slowly in cells transfected with the EB1-binding-deficient mutant than in cells transfected with wild-type MMG8 (Fig. 8C). These results indicated that the removal of


Accepted manuscript

EB1 from the GA impairs ER-to-Golgi transport of VSVG.

12

DISCUSSION In mammalian cells, the assembly of cisternal stacks into an integrated GA and the subcellular positioning of the GA depend on Golgi-associated microtubules (Rios et al., 2004; Rivero et al., 2009; Vinogradova et al., 2012). In this study, we identified and characterized a novel protein, MMG8, and demonstrated its crucial role in microtubule organization on the GA. MMG8 homologs were identified in chicken, Xenopus, and zebrafish in addition to those in mammals, suggesting that this protein is conserved in vertebrates. In the proliferating epithelial and fibroblast cultures examined, MMG8 was the only detected isoform encoded

Accepted manuscript

CDK5RAP2 and is expressed in muscles (Verde et al., 2001), was not detected in epithelial


by the MMG gene, which is multiply spliced. MMG1, a protein that is homologous to

centrosomal organization and functions, MMG8 functions at the GA in microtubule

cells and fibroblasts (supplementary material Fig. S1D). Like CDK5RAP2, MMG8 contains the SxIP motif that interacts with EB1/EB3. However, MMG8 does not contain the conserved γTuC-binding domain and the centrosome-targeting domain that are present at the amino- and carboxy-terminus, respectively, of CDK5RAP2 (Fong et al., 2008; Wang et al., 2010); instead, MMG8 interacts with TuCs and localizes to the GA through its amino-terminal region, which is not homologous to CDK5RAP2. Whereas CDK5RAP2 is involved in organization and efficient ER-to-Golgi trafficking. MMG8 is a cis-Golgi protein that localizes at the GA through its interaction with AKAP450. Supporting this view, MMG8 colocalized with AKAP450 at ER-exit sites after brefeldin-A treatment and at Golgi ministacks after microtubule depolymerization induced using nocodazole (supplementary material Fig. S3). Remarkably, MMG8 and AKAP450 were mostly present in the same subcellular complexes and their stability was mutually dependent. Therefore, these proteins likely form a functional complex when performing various functions. One such function involves mediating microtubule nucleation at cis-Golgi networks. AKAP450 is known to associate with TuCs (Hurtado et al., 2011; Takahashi et al., 2002), whereas MMG8 can interact with TuCs independently of AKAP450 (Fig. 5C). This study and those of others (Hurtado et al., 2011; Rivero et al., 2009) together indicate that the MMG8-AKAP450 complex anchors TuCs to cis-Golgi networks, where they nucleate microtubules. One of the effects of eliminating AKAP450 and thus Golgi-derived microtubules is impaired directional cell migration (Rivero et al., 2009); in agreement with 13

this finding, we observed defective migration of MMG8-depleted cells in a scratch-wounding assay. However, whether AKAP450 binds to TuCs through MMG8 remains unclear. One potential scenario is that by functioning as a scaffold protein on the GA, AKAP450 recruits MMG8 and CDK5RAP2 together with their bound TuCs. Another scenario is that both AKAP450 and MMG8 bind directly with TuCs; such interactions of TuCs within the complex could promote the Golgi attachment of the TuCs. In contrast to its essential role in the Golgi attachment of TuCs, MMG8 was dispensable for the centrosomal localization of TuCs (Fig. 5E). Therefore, TuCs are tethered to the GA through a mechanism distinct from


Accepted manuscript

that underlying their centrosomal localization. We determined that EB1 localized to the GA in an MMG8-dependent manner. This is supported by the observation that the expression of the EB1-binding-deficient mutant of MMG8 delocalized EB1 from the GA (Fig. 8A). These observations suggest that MMG8 tethers EB1/EB3 together with microtubule tips to Golgi membranes. Such a function is reminiscent of the binding of EB1 to STIM1, an SxIP motif-containing protein that associates with ER membranes (Grigoriev et al., 2008). Therefore, our results agree with the notion that EB1 complexes formed with other +TIPs mediate the attachment of microtubule tips to subcellular targets. Efficient ER-to-Golgi trafficking requires microtubules on which secretory cargos move toward the GA in association with the minus end-directed motor dynein-dynactin (Presley et al., 1997; Scales et al., 1997; Watson et al., 2005). Our results showed that MMG8 is required for microtubule-dependent ER-to-Golgi trafficking (Fig. 2C,E). Interestingly, this function of MMG8 required its binding with EB1/EB3 and thus the association of EB1/EB3 with the GA (Fig. 8). We envision that the EB1/EB3-mediated attachment of microtubules to the GA plays a crucial role in ER-to-Golgi trafficking. The transport efficiency was decreased in response to MMG8 silencing because of the disruption of Golgi-nucleated microtubules, although a direct role of MMG8 in trafficking cannot be excluded. Collectively, these observations suggest that MMG8 participates in various Golgi-associated activities by regulating Golgi-associated microtubules. MMG8 is involved in several activities that contribute toward ensuring the structural integrity of the GA. First, MMG8 is required for recruiting TuCs to, and thus enabling 14

microtubule nucleation on, the GA. Second, MMG8 interacts with EB1/EB3 and thereby attaches microtubule tips to the GA. During Golgi biogenesis, Golgi- and centrosomeoriginated microtubules are required for facilitating the assembly of Golgi ministacks into larger clusters and for gathering Golgi fragments for central positioning (Miller et al., 2009; Vinogradova et al., 2012). Third, the knockdown of MMG8 affects ER-to-Golgi transport and thus perturbs the delivery of proteins and membranes that are required for the assembly and maintenance of the Golgi structure (Diao et al., 2008; Marra et al., 2007). Fourth, MMG8 is required for stabilizing AKAP450, which recruits several regulatory molecules such as PKA (Schmidt et al., 1999; Takahashi et al., 1999; Witczak et al., 1999). Notably, PKA is required

Accepted manuscript

2010). We observed that the overexpression of MMG8 caused a disorganization of the GA


for Golgi biogenesis and structural reorganization (Bejarano et al., 2006; Mavillard et al.,

trafficking and Golgi structural organization.

(supplementary material Fig. S2). Therefore, ensuring proper structural organization of the GA appears to require maintaining the homeostasis of Golgi-localized MMG8. Collectively, the data presented herein support a model in which MMG8 regulates microtubule organization on the GA by forming functional complexes with AKAP450, γTuCs, and EB1/EB3. These MMG8 functions are required for efficient ER-to-Golgi

15

MATERIALS AND METHODS Plasmids and oligonucleotides The human MMG clone NP_001002811 (MMG variant 5) was obtained from the Kazusa DNA Research Institute (Kisarazu, Chiba, Japan). The coding sequence of MMG8 was constructed by replacing a carboxy-terminal sequence of NP_001002811 with the corresponding MMG8 sequence amplified using RT-PCR. The protein and nucleotide sequences of MMG8 have been deposited in GenBank under accession number HQ333476. Mutations were introduced into MMG8 by means of PCR-based site-directed mutagenesis. duplexes

were

synthesized

to

target

MMG8

(si-MMG8-1,

Accepted manuscript

siRNA

AACCUCCAGUGGCUGAAAGAA; si-MMG8-2, AAGCAGAGAGACAGCUCUAUA); an


Two

nitrilotriacetic acid resins (Qiagen, Valencia, CA) in the presence of 6 M urea and were then

siRNA

duplex

was

also

synthesized

against

human

AKAP450

(si-AKAP450,

AACUUUGAAGUUAACUAUCAA) (Rivero et al., 2009). Antibodies Two MMG8 fragments, 637–925 and 926–1116, were cloned for bacterial expression in fusion with a hexahistidine (His6) tag. The recombinant proteins were purified using Ni2+dialyzed against phosphate-buffered saline (PBS). After dialysis, the proteins were used for immunizing rabbits. Antisera generated against 637–925 and 926–1116 were designated as 443M and 532C, respectively. Antibodies were purified from the sera by using the respective antigens immobilized on nitrocellulose membranes. Using similar methods, an antibody was generated against the AKAP450 fragment 1924–2170 and was purified. The generation of anti-GCP2 and anti-GCP3 antibodies has been described previously (Choi et al., 2010; Fong et al., 2008). The following monoclonal antibodies were from commercial sources: antiGM130, anti-AKAP450, and anti-EB1 from BD Biosciences (Franklin Lakes, NJ); and antiα-tubulin, anti-γ-tubulin, and anti-FLAG (M2) from Sigma Aldrich (St. Louis, MO). The polyclonal antibodies purchased were anti-FLAG (Sigma Aldrich), anti-GFP (FL, Santa Cruz Biotechnology, Dallas, TX), anti-mannosidase II (Millipore, Billerica, MA), and anti-TGN46 (sheep polyclonal, Serotec, Kidlington, Oxford, UK). Cell culture Mammalian cells were cultured in media containing 10% fetal bovine serum and were maintained at 37°C in 5% CO2. HeLa, HEK293T, MCF-7, IMR-5 (a human neuroblastoma 16

cell line), and C2C12 (a mouse myoblast line) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM); human retinal pigment epithelial cells hTERT-RPE1 (RPE1) were grown in DMEM:Ham’s F12 (1:1) (Life Technologies, Carlsbad, CA); and MRC-5 human fetal-lung fibroblasts were grown in MEM (Life Technologies). C2C12 myoblasts were differentiated into myotubes by using DMEM supplemented with 2% horse serum. BrefeldinA, nocodazole, cycloheximide, and MG132 were purchased from Sigma Aldrich. Immunoprecipitation and pull-down assays Transfected proteins were immunoprecipitated through their ectopic tags by using cell

Accepted manuscript

Triton X-100, 1 mM dithiothreitol, and a protease-inhibitor cocktail [Roche, Basel,


extracts prepared in lysis buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1%

sample buffer. To prepare samples for mass-spectrometry analysis, protein bands visualized

Switzerland]). To immunoprecipitate endogenous MMG8, cell extracts were prepared in RIPA buffer (25 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, and 0.1% SDS) supplemented with the protease-inhibitor cocktail and then clarified. After preclearing with Protein A-Agarose (Life Technologies), the extracts were incubated with agitation at 4°C for 4 h with an MMG8 antibody bound to Protein A-conjugated beads. After extensive washing, the immunoprecipitates were eluted by boiling the beads in SDS-PAGE by means of Coomassie Blue staining were excised and subjected to in-gel tryptic digestion. The peptides recovered were introduced through a nanoelectrospray ion source into a quadrupole/time-of-flight mass spectrometer (QSTAR-Pulsar, Applied Biosystems/Sciex, Foster City, CA). Protein identity was revealed by searching a nonredundant sequence database with tandem mass spectra. In the pull-down assay of TuCs, FLAG-MMG8 transiently expressed in HEK293T cells was immunoprecipitated using anti-FLAG-coupled beads (M2, Sigma Aldrich) in the RIPA buffer. After immunoprecipitation, the beads were washed with the RIPA buffer and with the lysis buffer supplemented with 0.1% Tween-20. The beads were then tested for binding with TuCs in extracts of RPE1 cells prepared using the lysis buffer containing 0.1% Tween-20. After sedimenting the beads, bound proteins were examined by means of immunoblotting. Immunofluorescence microscopy 17

To perform immunostaining, cells were fixed either with cold methanol for 5 min at -20°C or with 4% paraformaldehyde/PBS for 15 min at room temperature. After staining, cell images were acquired using an epifluorescence microscope (Eclipse TE2000, Nikon, Tokyo, Japan) or a confocal microscope (LSM510 META, Carl Zeiss, Jena, Germany). To visualize tubulin at the GA, cells were extracted for 30 min in a saponin-containing buffer (0.1 M 1,4piperazinediethanesulfonic acid-KOH, pH 6.9, 2 M glycerol, 5 mM MgCl2, 2 mM EGTA, and 0.1% saponin) before methanol fixation. To enhance staining signals, cells were stained sequentially with 2 secondary antibodies: AlexaFluor dye-labeled goat secondary antibodies and then donkey anti-goat secondary antibodies labeled with the same dye (Life


Accepted manuscript

Technologies). VSVG trafficking assay At 72 h after transfection with siRNAs, cells were transfected with a VSVG-YFP plasmid and then cultured at 40°C overnight. To initiate the trafficking assays, the cells were changed to a medium that contained 100 µg/mL of cycloheximide and was prewarmed to 32°C; the cells were incubated at 32°C for various times and then either analyzed for Endo-H resistance or immunostained. Endo-H resistance was assayed according the manufacturer’s protocol (New England Biolabs, Ipswich, MA). Briefly, cells were collected in SDS-PAGE sample buffer and boiled for 10 min. After boiling, the samples were mixed with 1 U/μL Endo H and then incubated at 37°C for 4 h before immunoblotting for VSVG (by using anti-YFP). To analyze the subcellular distribution of VSVG, the cells were fixed with methanol at -20°C for 5 min and then immunostained. Isolation of Golgi membranes The protocol used for isolating Golgi membranes was adapted from methods described elsewhere (Malhotra et al., 1989). Cells were homogenized in ice-cold homogenization buffer (10 mM Tris-HCl, pH 7.4, 0.5 M sucrose, 5 mM EDTA, and the protease-inhibitor cocktail). The homogenates were centrifuged at 900 × g for 10 min at 4C to remove nuclei and intact cells. The postnuclear supernatant (1 mL) was layered on top of 1.25 M sucrose (1 mL; dissolved in 10 mM Tris-HCl, pH 7.4) and centrifuged at 90,000 × g for 90 min at 4C in an ultracentrifuge by using a TLS-55 swinging-bucket rotor (Beckman Coulter, Brea, CA). The crude smooth-membrane fraction, which appeared as a white band immediately above the interface with the 1.25-M-sucrose layer, was collected through aspiration and adjusted to 1.2 18

M sucrose. This membrane fraction (0.6 mL) was sequentially overlaid with 1.1, 1.0, and 0.5 M sucrose (0.5 mL of each sucrose solution, prepared in 10 mM Tris-HCl, pH 7.4) and then centrifuged at 90,000 × g for 2.5 h at 4C in the TLS-55 rotor. The Golgi membranes, which were enriched at the interface of 0.5 M/1.0 M sucrose, were collected, diluted 1:3 with 10 mM Tris-HCl (pH 7.4), and pelleted by centrifugation (180,000 × g for 60 min at 4C) and then used in immunoblotting analysis. Microtubule regrowth Cellular microtubules were completely depolymerized by placing cells on ice for 1 h or by treated cells were transferred to a 37°C water bath. Nocodazole-treated cells were washed several times with ice-cold PBS and then incubated in medium that was prewarmed to 37°C. To reduce background cytoplasmic staining, cells were extracted briefly before fixation by using a cytoskeleton-stabilizing buffer (50 mM imidazole, pH 6.8, 50 mM KCl, 0.5 mM MgCl2, 1 mM EGTA, 0.1 mM EDTA, 4% PEG4000, and 0.1% saponin) (Svitkina et al., 1996). Microtubules were analyzed using immunofluorescence microscopy.


Accepted manuscript

treating them with 10 µg/mL nocodazole for 2 h. To initiate microtubule regrowth, cold-

19

Acknowledgements We thank Dr. Wanjin Hong (Institute of Molecular and Cell Biology, Singapore), Dr. Adam D. Linstedt (Carnegie Mellon University), and Dr. Sigurd Ørstavik (Oslo University Hospital, Norway) for reagents. We are also in debt to Dr. Yanzhuang Wang (University of Michigan) for valuable discussions and to Jason Tam and Xulun Sun for technical assistance. This work was supported by grants from the Research Grants Council (General Research Fund 662511 and 662612 and Theme-based Research Scheme T13-607/12R) of Hong Kong, the National Key Basic Research Program of China (2013CB530900), the University Grants Committee (Area of Excellence Scheme AoE/M-06/08 and Special Equipment Grant SEG_HKUST05)

Accepted manuscript

and the TUYF Charitable Trust (TUYF12SC05).


of Hong Kong, the Innovation and Technology Commission (ITCPD/17-9) of Hong Kong,

The authors declare no competing interests.

Author contributions Z.W., C.Z., and R.Z.Q. designed the experiments. Z.W. and C.Z. conducted the experiments. Z.W., C.Z., and R.Z.Q. analyzed the data. Z.W. and R.Z.Q. wrote the paper. Competing interests

20

References Akhmanova, A. and Steinmetz, M. O. (2008). Tracking the ends: a dynamic protein network controls the fate of microtubule tips. Nat Rev Mol Cell Biol 9, 309-22. Bejarano, E., Cabrera, M., Vega, L., Hidalgo, J. and Velasco, A. (2006). Golgi structural stability and biogenesis depend on associated PKA activity. J Cell Sci 119, 376475. Chabin-Brion, K., Marceiller, J., Perez, F., Settegrana, C., Drechou, A., Durand, G. and Pous, C. (2001). The Golgi complex is a microtubule-organizing organelle. Mol Biol


Accepted manuscript

Cell 12, 2047-60. Choi, Y. K., Liu, P., Sze, S. K., Dai, C. and Qi, R. Z. (2010). CDK5RAP2 stimulates microtubule nucleation by the gamma-tubulin ring complex. J Cell Biol 191, 108995. Cole, N. B., Sciaky, N., Marotta, A., Song, J. and Lippincott-Schwartz, J. (1996). Golgi dispersal during microtubule disruption: regeneration of Golgi stacks at peripheral endoplasmic reticulum exit sites. Mol Biol Cell 7, 631-50. Diao, A., Frost, L., Morohashi, Y. and Lowe, M. (2008). Coordination of golgin tethering and SNARE assembly: GM130 binds syntaxin 5 in a p115-regulated manner. J Biol Chem 283, 6957-67. Efimov, A., Kharitonov, A., Efimova, N., Loncarek, J., Miller, P. M., Andreyeva, N., Gleeson, P., Galjart, N., Maia, A. R., McLeod, I. X. et al. (2007). Asymmetric CLASPdependent nucleation of noncentrosomal microtubules at the trans-Golgi network. Dev Cell 12, 917-30. Fong, K. W., Choi, Y. K., Rattner, J. B. and Qi, R. Z. (2008). CDK5RAP2 is a pericentriolar protein that functions in centrosomal attachment of the gamma-tubulin ring complex. Mol Biol Cell 19, 115-25. Fong, K. W., Hau, S. Y., Kho, Y. S., Jia, Y., He, L. and Qi, R. Z. (2009). Interaction of CDK5RAP2 with EB1 to track growing microtubule tips and to regulate microtubule dynamics. Mol Biol Cell 20, 3660-70. Grigoriev, I., Gouveia, S. M., van der Vaart, B., Demmers, J., Smyth, J. T., Honnappa, S., Splinter, D., Steinmetz, M. O., Putney, J. W., Jr., Hoogenraad, C. C. et al. (2008). STIM1 is a MT-plus-end-tracking protein involved in remodeling of the ER. Curr Biol 18, 177-82. 21

Honnappa, S., Gouveia, S. M., Weisbrich, A., Damberger, F. F., Bhavesh, N. S., Jawhari, H., Grigoriev, I., van Rijssel, F. J., Buey, R. M., Lawera, A. et al. (2009). An EB1-binding motif acts as a microtubule tip localization signal. Cell 138, 366-76. Hurtado, L., Caballero, C., Gavilan, M. P., Cardenas, J., Bornens, M. and Rios, R. M. (2011). Disconnecting the Golgi ribbon from the centrosome prevents directional cell migration and ciliogenesis. J Cell Biol 193, 917-33. Keryer, G., Rios, R. M., Landmark, B. F., Skalhegg, B., Lohmann, S. M. and Bornens, M. (1993). A high-affinity binding protein for the regulatory subunit of cAMPdependent protein kinase II in the centrosome of human cells. Exp Cell Res 204, 230-40.

Accepted manuscript

Schober, J. M., Honnappa, S., Buey, R. M., Hoogenraad, C. C., Dogterom, M. et al.


Komarova, Y., De Groot, C. O., Grigoriev, I., Gouveia, S. M., Munteanu, E. L.,

through the Golgi stack. Cell 58, 329-36.

(2009). Mammalian end binding proteins control persistent microtubule growth. J Cell Biol 184, 691-706. Lippincott-Schwartz, J. (1998). Cytoskeletal proteins and Golgi dynamics. Curr Opin Cell Biol 10, 52-9. Malhotra, V., Serafini, T., Orci, L., Shepherd, J. C. and Rothman, J. E. (1989). Purification of a novel class of coated vesicles mediating biosynthetic protein transport Marra, P., Salvatore, L., Mironov, A., Jr., Di Campli, A., Di Tullio, G., Trucco, A., Beznoussenko, G., Mironov, A. and De Matteis, M. A. (2007). The biogenesis of the Golgi ribbon: the roles of membrane input from the ER and of GM130. Mol Biol Cell 18, 1595-608. Mavillard, F., Hidalgo, J., Megias, D., Levitsky, K. L. and Velasco, A. (2010). PKA-mediated Golgi remodeling during cAMP signal transmission. Traffic 11, 90-109. Miller, P. M., Folkmann, A. W., Maia, A. R., Efimova, N., Efimov, A. and Kaverina, I. (2009). Golgi-derived CLASP-dependent microtubules control Golgi organization and polarized trafficking in motile cells. Nat Cell Biol 11, 1069-80. Presley, J. F., Cole, N. B., Schroer, T. A., Hirschberg, K., Zaal, K. J. and Lippincott-Schwartz, J. (1997). ER-to-Golgi transport visualized in living cells. Nature 389, 81-5. Rios, R. M. and Bornens, M. (2003). The Golgi apparatus at the cell centre. Curr Opin Cell Biol 15, 60-6.

22

Rios, R. M., Sanchis, A., Tassin, A. M., Fedriani, C. and Bornens, M. (2004). GMAP-210 recruits gamma-tubulin complexes to cis-Golgi membranes and is required for Golgi ribbon formation. Cell 118, 323-35. Rivero, S., Cardenas, J., Bornens, M. and Rios, R. M. (2009). Microtubule nucleation at the cis-side of the Golgi apparatus requires AKAP450 and GM130. Embo J 28, 1016-28. Scales, S. J., Pepperkok, R. and Kreis, T. E. (1997). Visualization of ER-to-Golgi transport in living cells reveals a sequential mode of action for COPII and COPI. Cell 90, 1137-48.

Accepted manuscript

Milgram, S. L. and Goldenring, J. R. (1999). AKAP350, a multiply spliced protein kinase


Schmidt, P. H., Dransfield, D. T., Claudio, J. O., Hawley, R. G., Trotter, K. W.,

Takahashi, M., Shibata, H., Shimakawa, M., Miyamoto, M., Mukai, H. and Ono,

A-anchoring protein associated with centrosomes. J Biol Chem 274, 3055-66. Sutterlin, C. and Colanzi, A. (2010). The Golgi and the centrosome: building a functional partnership. J Cell Biol 188, 621-8. Svitkina, T. M., Verkhovsky, A. B. and Borisy, G. G. (1996). Plectin sidearms mediate interaction of intermediate filaments with microtubules and other components of the cytoskeleton. J Cell Biol 135, 991-1007. Y. (1999). Characterization of a novel giant scaffolding protein, CG-NAP, that anchors multiple signaling enzymes to centrosome and the golgi apparatus. J Biol Chem 274, 1726774. Takahashi, M., Yamagiwa, A., Nishimura, T., Mukai, H. and Ono, Y. (2002). Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Mol Biol Cell 13, 3235-45. Verde, I., Pahlke, G., Salanova, M., Zhang, G., Wang, S., Coletti, D., Onuffer, J., Jin, S. L. and Conti, M. (2001). Myomegalin is a novel protein of the golgi/centrosome that interacts with a cyclic nucleotide phosphodiesterase. J Biol Chem 276, 11189-98. Vinogradova, T., Paul, R., Grimaldi, A. D., Loncarek, J., Miller, P. M., Yampolsky, D., Magidson, V., Khodjakov, A., Mogilner, A. and Kaverina, I. (2012). Concerted effort of centrosomal and Golgi-derived microtubules is required for proper Golgi complex assembly but not for maintenance. Mol Biol Cell 23, 820-33. Wang, Z., Wu, T., Shi, L., Zhang, L., Zheng, W., Qu, J. Y., Niu, R. and Qi, R. Z. (2010). Conserved motif of CDK5RAP2 mediates its localization to centrosomes and the Golgi complex. J Biol Chem 285, 22658-65. 23

Watson, P., Forster, R., Palmer, K. J., Pepperkok, R. and Stephens, D. J. (2005). Coupling of ER exit to microtubules through direct interaction of COPII with dynactin. Nat Cell Biol 7, 48-55. Witczak, O., Skalhegg, B. S., Keryer, G., Bornens, M., Tasken, K., Jahnsen, T. and Orstavik, S. (1999). Cloning and characterization of a cDNA encoding an A-kinase


Accepted manuscript

anchoring protein located in the centrosome, AKAP450. Embo J 18, 1858-68.

24

Figure Legends Fig. 1. MMG8 is a novel cis-Golgi protein. (A) HeLa extracts resolved using SDS-PAGE (6% and 15% gels) were probed with an anti-MMG8 antibody (443M) or the preimmune serum (PS). (B) HeLa extracts prepared in RIPA buffer were used for immunoprecipitation (IP). The immunoprecipitates were resolved using SDS-PAGE and immunoblotted with antiMMG8 or stained with Coomassie Blue. The protein of ~150 kDa was excised for sequencing through mass spectrometry. (C) A schematic representation of the MMG variants. Identical sequence regions are shown in the same color. P1–P13 denote peptides sequenced

Accepted manuscript

stained for MMG8 and Golgi proteins. Boxed areas are enlarged on the right. Scale bars, 5


using mass spectrometry. (D) Representative micrographs (100% of 100 cells) of HeLa cells

siRNA were analyzed using immunofluorescence microscopy. The knockdown of MMG8

µm. Fig. 2. MMG8 is required for Golgi structural organization and efficient ER-to-Golgi transport. (A) Immunoblotting of HeLa cells transfected with control or mmg8-targeting siRNAs. The transfection of MMG8 siRNAs (si-MMG8-1 and si-MMG8-2) suppressed the protein’s expression by ~85%. (B) RPE1 cells transfected with control or mmg8-targeting was rescued by the transfection of an siRNA-resistant construct (FLAG-MMG8). The boxed regions are enlarged. The figure shows representative micrographs of ~1000 cells (n = 3). (C) HeLa cells were transfected with VSVG-YFP. The cells were extracted at various times during incubation at 32°C and were assayed for Endo-H resistance. Following the assay, the samples were immunoblotted to check for VSVG. The amounts of the Endo-H-resistant form of VSVG relative to the total amounts of VSVG were determined, and quantification data from 3 independent experiments are presented here. (D) Cells were fixed at 0 or 40 min of 32°C incubation and then immunostained. At least 90% of the 200 cells analyzed for each condition exhibited the phenotypes shown. (E–F) Cells expressing VSVG-YFP were treated with 10 µg/mL nocodazole at 40°C for 6 h and then shifted to 32°C and incubated further. The figure shows the results of the Endo-H-resistance assay (E) of cells collected at various times (from 3 independent experiments) and the representative images of cells (>90% of 100 cells) that were fixed after incubation for 15 min at 32°C (F). Scale bars, 5 µm. Fig. 3. MMG8 targets to the GA by interacting with AKAP450. (A) Anti-MMG8 and anti-AKAP450 immunoprecipitations (IPs) were performed using HeLa extracts. The 25

immunoprecipitated proteins and inputs were analyzed by immunoblotting and quantifying the samples. The histogram shows the amount of the precipitated proteins relative to that of the respective inputs. Data shown are means ± s.d. obtained from 3 independent experiments. (B) Proteins coimmunoprecipitated with MMG8 were stained with Sypro Ruby or detected on immunoblots (IBs). The Sypro Ruby intensities of MMG8 and AKAP450 were quantified. Data from 3 independent experiments showed that the molar ratio of AKAP450 to MMG8 was 0.98 ± 0.1. (C) HEK293T cells expressing FLAG-MMG8 constructs were subjected to anti-FLAG immunoprecipitation. The immunoprecipitates and inputs were immunoblotted (IB) for the MMG8 proteins (anti-FLAG) and AKAP450. (D) RPE1 cells were double-

Accepted manuscript

ectopically expressed (GFP) in HeLa cells. The cells were examined for the transfected


stained for AKAP450 and MMG8. The boxed area is enlarged. (E) MMG8 fragments were

cells transfected with indicated siRNAs were immunoblotted. After quantification, the

proteins and a Golgi marker. The boxed areas are enlarged. (F) HeLa cells in which MMG8 or AKAP450 was depleted using RNAi were treated with MG132 for 12 h. The cells were then immunostained. The phenotypes shown in (E–F) were observed in >90% of 100 cells analyzed for each sample. Scale bars, 5 µm. Fig. 4. MMG8 and AKAP450 are mutually dependent for stability. (A) Extracts of RPE1 amounts of MMG8 and AKAP450 in the extracts of si-MMG8- and si-AKAP450-transfected cells were expressed as percentages of the respective amounts in the control extracts. Data from 3 independent experiments are shown. (B) At 72 h after transfection with siRNAs, cells were treated with MG132, after which cell extracts were prepared and immunoblotted. The amounts of MMG8 and AKAP450 are plotted using the data quantified from 3 independent experiments. Fig. 5. MMG8 associates with γTuCs and is required for γTuC attachment to the GA. (A–B) Anti-MMG8 (A) and anti-GCP3 (B) immunoprecipitations (IPs) were performed using HeLa extracts. The immunoprecipitates and inputs were immunoblotted. (C) FLAG-MMG8 and

FLAG-MMG8(389–1116)

transiently

expressed

in

HEK293T

cells

were

immunoprecipitated in RIPA buffer. The beads were then used in a pull-down assay together with RPE1 lysates of cells that were transfected with control or AKAP450 siRNA. The pulldowns were examined on immunoblots. (D) RPE1 cells were double-stained for γ-tubulin and MMG8. (E) Cells transfected with siRNAs were immunostained for γ-tubulin and mannosidase II (Man II). Arrows indicate centrosomes. Images shown in (D–E) are 26

representatives (>90%) of 200 cells analyzed for each sample. Scale bars, 5 µm. (F) Golgi membranes were isolated from siRNA-transfected cells. Both the Golgi fractions and the whole cell lysates (WCLs) were analyzed on the immunoblots. The histogram shows the protein quantification of the isolated Golgi membranes from 3 independent experiments; **, P < 0.01. Fig. 6. MMG8 is required for microtubule nucleation at the GA. (A) RPE1 cells were transfected with siRNAs. After cold-induced depolymerization, microtubule regrowth was initiated by warming the cells to 37°C. The cells were then stained for MMG8, TGN46, and

Accepted manuscript

after nocodazole-induced depolymerization. In (A) and (B), the images shown represent


microtubules (anti-α-tubulin). MTs, microtubules. (B) Microtubule regrowth was performed

Fig. 7. MMG8 binds to EB1 and mediates its recruitment to the GA. (A) Anti-MMG8

>90% of 100–200 cells analyzed for each condition. (C) Immunofluorescence micrographs of cells transfected with siRNAs. The boxed areas are enlarged. The fluorescence intensities of microtubules were measured at the Golgi area and in the cytoplasm. After subtracting the background, the ratios of Golgi/cytoplasm were derived (n = 30 cells for each quantification; error bars, s.d.). Ctrl, control. Scale bars, 5 µm.

immunoprecipitation was performed and the immunoprecipitates and inputs were immunoblotted. (B) MMG8 contains the SxIP (x denotes any amino acid residue) motif that is required for interaction with EB1; residues highlighted in black are critical for EB1 binding. Pongo abelii MMG8, NP_001126198; mouse MMG8, NP_835181. (C) MMG8 and its L311A/P312A mutant (311/2A) were ectopically expressed. After immunoprecipitating the proteins by targeting the tag (anti-FLAG IP), the immunoprecipitates and inputs were immunoblotted. Vector, FLAG vector; WT, MMG8 wild-type. (D) HEK293T cells were doubly transfected with GFP-EB3 and the MMG8 constructs. The immunoprecipitates and inputs were analyzed for EB3 (anti-GFP) and MMG8 (anti-FLAG). (E–F) HeLa cells transfected with siRNAs were triple-stained for MMG8, EB1, and TGN46. The cells were either left untreated (E) or were extracted with a saponin-containing buffer (F) before fixation. The boxed areas are enlarged. (G) Cells transfected with siRNAs were treated with nocodazole to depolymerize microtubules, after which the cells were immunostained. The boxed areas are enlarged. The images shown for all immunofluorescence experiments represent >90% of ~500 cells analyzed for each condition. Scale bars, 5 µm. 27

Fig. 8. Golgi-associated EB1 is required for efficient ER-to-Golgi trafficking. (A) RPE1 cells transfected with MMG8 and its mutant were immunostained. WT, wild-type MMG8; 311/2A, MMG8(L311A/P312A). The boxed regions are enlarged. Every analyzed cell (n = 100) showed the presented phenotypes. (B–C) VSVG-YFP was coexpressed with the MMG8 constructs to evaluate protein trafficking. The representative images shown (B) are of cells (>80% of 100 cells) at 0 or 15 min after transfer to 32°C. Scale bars, 5 µm. (C) Endo-H


Accepted manuscript

resistance of VSVG was quantified using data from 3 separate experiments.

28

Supplementary Figures Fig. S1. Detection of MMG8 expression. (A) An RT-PCR reaction was performed using oligonucleotide primers (Forward primer: 5ʹ-CTTGAGAAACTTCGCCAGCGAAT-3ʹ; Reverse primer: 5ʹ-AAGTTCCTCTTTGGCATTACTCAG-3ʹ) that targeted a region present in several MMG variants. Total RNA was extracted from HeLa cells by using TRIZOL (Life Technologies). Reverse transcription was performed using the First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA). M, DNA molecular-weight markers; cDNA, cDNA prepared through reverse transcription of HeLa RNA; RNA, RNA extracted from HeLa cells.


Accepted manuscript

(B) After immunoprecipitation performed using 443M, the captured ~150 kDa protein was analyzed by means of mass spectrometry. The peptides revealed by tandem mass spectrometry are shown. (C) Schematic representation of antibody-targeted regions and predicted domains of MMG8. (D) MMG8 expression was examined in cell cultures by immunoblotting extracts with 443M. Fig. S2. Overexpression of MMG8 causes Golgi fragmentation. HeLa cells transiently expressing FLAG-MMG8 at distinct levels were immunostained for FLAG-MMG8 (antiFLAG) and GM130. At least 80% of the 200 cells analyzed showed the presented phenotypes for each condition. Scale bar, 5 µm. Fig. S3. Colocalization of MMG8 and AKAP450 on fragmented Golgi. RPE1 cells were treated with brefeldin-A (1 h, 10 µg/mL) or nocodazole (1.5 h, 10 µM). The cells were then double-stained for AKAP450 and MMG8. The boxed areas are enlarged. Scale bar, 5 µm. Fig. S4. Dissociation of MMG8 from AKAP450 and TuCs in RIPA buffer. FLAGMMG8 was immunoprecipitated from HEK293T extracts prepared in RIPA buffer or in lysis buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1 mM dithiothreitol, and the protease-inhibitor cocktail). The immunoprecipitates were washed in the respective buffers before immunoblotting analyses.

29


Accepted manuscript


Accepted manuscript


Accepted manuscript


Accepted manuscript


Accepted manuscript


Accepted manuscript


Accepted manuscript


Accepted manuscript

JOURNAL OF CELL SCIENCE ACCEPTED MANUSCRIPT

Recommend Documents