JOURNAL OF CELL SCIENCE ACCEPTED MANUSCRIPT

© 2012. Published by The Company of Biologists Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Share Alike License (http://creativecommons.org/licenses/by-nc-sa/3.0), which permits unrestricted non-commercial use, distribution and reproduction in any medium provided that the original work is properly cited and all further distributions of the work or adaptation are subject to the same Creative Commons License terms.

Wnt3a-stimulated LRP6 phosphorylation is dependent upon arginine methylation of G3BP2 Rama Kamesh Bikkavilli*, and Craig C. Malbon Department of Pharmacology, School of Medicine, Health Sciences Center, State University of New York at Stony Brook, Stony Brook, NY 11794-8651

Running title: Arginine methylation of G3BP2 regulates LRP6 phosphorylation

Journal of Cell Science

Accepted manuscript

Keywords: Wnt, LRP5/6 phosphorylation, -catenin, G3BP2, arginine methylation, Dishevelled, Frizzled, protein arginine methyl transferase, PRMT.

* To whom correspondence should be addressed Dr. Rama Kamesh Bikkavilli, Department of Pharmacology, Health Sciences Center, State University of New York at Stony Brook, Stony Brook, NY 11794-8651 USA Phone: 631-444-7873 FAX: 631-444-7696 E-mail: [email protected]

1

JCS online publication date 5 April 2012

Summary Wnt signaling is initiated upon binding of Wnts to Frizzleds and their co-receptors LRP5/6. The signal is then propagated to several downstream effectors, mediated by the phosphoprotein scaffold, Dishevelled. We report a novel role for arginine methylation in regulating Wnt3astimulated LRP6 phosphorylation. G3BP2, a Dishevelled-associated protein, is methylated in response to Wnt3a. The Wnt3a-induced LRP6 phosphorylation is attenuated by G3BP2 knock-

mutants of G3BP2. Arginine methylation of G3BP2 appears to be a Wnt3a-sensitive “switch” regulating LRP6 phosphorylation and canonical Wnt/β-catenin signaling.


Accepted manuscript

down, chemical inhibition of methyl transferase activity, or expression of methylation-deficient

2

Introduction Wnt/β-catenin signaling is essential for normal embryonic development and adult tissue homeostasis (Polakis, 2000; Moon et al., 2002; Logan and Nusse, 2004; Malbon, 2005a; Malbon, 2005b; Reya and Clevers, 2005; Polakis, 2007). Wnt signaling is initiated upon binding of Wnt to Frizzled and its co-receptor low density lipoprotein receptor-related protein 5/6 (LRP5/6). The


Accepted manuscript

signal is then propagated downstream, mediated by a phosphoprotein scaffold, Dishevelled (Dvl), leading to post-transcriptional and post-translational mechanisms-mediated stabilization of βcatenin (Malbon and Wang, 2006; Angers and Moon, 2009; Bikkavilli and Malbon, 2010; Bikkavilli and Malbon, 2011). Nuclear accumulation of the stabilized β-catenin follows stimulatory activation of Lef/Tcf-sensitive transcription of developmentally regulated genes (Behrens et al., 1996; Molenaar et al., 1996). Wnt binding to Frizzled and LRP6 forms a stable complex that aggregates into LRP6 signalosomes (He et al., 2004; MacDonald et al., 2008; Niehrs and Shen, 2010). The LRP6 signalosome formation stimulates phosphorylation of LRP6 at multiple sites via distinct kinases, including casein kinase1γ (CK1γ) and glycogen synthase kinase-3β (GSK3β) (Tamai et al., 2004; Davidson et al., 2005; Zeng et al., 2005). Wnt-stimulated LRP6 phosphorylation provokes recruitment of Axin to LRP6. This preferential binding of Axin to phosphorylated LRP6 releases β-catenin from its regulatory degradation and promotes its stabilization (Tamai et al., 2004; Zeng et al., 2005). The Wnt-stimulated LRP6 phosphorylation is also tightly regulated. Dikkopf (DKK), for example, antagonizes Wnt signaling through LRP6 binding and internalization (Brott and Sokol, 2002; Semenov et al., 2008; Binnerts et al., 2009; Li et al., 2010). Similarly, CK1γ and GSK3β were also shown to regulate LRP6 activity in response to Wnt (Zeng et al., 2005). A

3

recent study also highlighted an important role for phosphatidylinositol 4,5 bisphosphate in regulation of LRP6 phosphorylation (Pan et al., 2008). Although, Dvls play an important role in regulating LRP6 phosphorylation (Bilic et al., 2007), the possible mechanism has not been examined. Dvls are dynamic, scaffolding molecules (Malbon and Wang, 2006; Gao and Chen, 2010), which can oligomerize (Schwarz-Romond et al., 2007) and/or polymerize into large supermolecular structures (Yokoyama et al., 2010). However,


Accepted manuscript

the cellular signals that provoke their formation remain unclear. We reported an important role for arginine methylation as a “molecular switch” in regulating the disassembly of G3BP1 from the Dvl3-based supermolecular complexes (Bikkavilli and Malbon, 2011). In the present study, we identify a novel role for arginine methylation and its substrate Ras GTPase activating proteinbinding protein 2 (G3BP2) in regulating Wnt3a-stimulated LRP6 phosphorylation. Depletion of G3BP2, chemical inhibition of protein methyl transferase activity, and expression of methylationdeficient G3BP2: all attenuate Wnt3a-induced LRP6 phosphorylation, revealing novel nodes of regulation for Wnt pathway.

4

Results G3BP2 is a novel Dvl3-associated protein We performed proteomic analysis of Dvl3-based supermolecular complexes (Yokoyama et al., 2010) following affinity pull-downs (Bikkavilli and Malbon, 2010; Bikkavilli and Malbon, 2011). Multiple peptides (highlighted in blue, Fig. 1A) constituting more than 50% of sequence


Accepted manuscript

identified Ras GTPase activating protein-binding protein 2 (G3BP2) as a Dvl3-associated protein (Fig. 1A). The primary structure of G3BP2, similar to its G3BP1 isoform identified earlier (Bikkavilli and Malbon, 2011), displays an N-terminal nuclear transport factor 2 like domain (NTF2), an RNA recognition motif (RRM domain), and a glycine arginine rich (GAR) region (Fig. 1B). Dvl3 pull-downs (i.e., immunoprecipitations) performed with lysates of F9 teratocarcinoma cells expressing Myc-G3BP2 confirm Dvl3-G3BP2 association (Fig. 1C). Such interactions were not obtained in control IgG pull-downs (Fig. 1C). Pull-downs performed with anti-HA antibodies on lysates of F9 cells expressing exogenous Dvl3 (HA-Dvl3) and MycG3BP2 also demonstrated a positive Dvl3-G3BP2 association (Fig. 1D). Interestingly, among the three Dvl isoforms (Dvl1, Dvl2 and Dvl3), G3BP2 displayed greatest amount of binding to Dvl3 isoform (Fig. 1E). Dvl3-G3BP2 association is not confined to F9 cells; HEK293 cells also displayed Dvl3-G3BP2 association (Fig. 1F). G3BP2 association with Dvl3-based supermolecular complexes increased in cells treated with Wnt3a (Fig. 1F).

5

G3BP2 depletion blocks Wnt/β-catenin signaling As the Dvl3-G3BP2 association was Wnt3a sensitive (Fig. 1E), we probed if G3BP2 contributed directly or indirectly to Wnt/β-catenin signaling. Small interference RNAs (siRNAs) were designed against G3BP2 and tested for their effects on G3BP2 expression and on three read-outs stimulated by Wnt: β-catenin stabilization, Lef/Tcf-sensitive gene transcription and primitive-


Accepted manuscript

endoderm (PE) formation (Fig. 2). Treatment of clones stably expressing Fz1 receptor with G3BP2-specific siRNAs effectively knocked-down (>90%) G3BP2 expression (Fig. 2A). The additional band (~ 52 KDa) corresponds to G3BP2β, a spliced isoform of G3BP2α (French et al., 2002; Irvine et al., 2004). Loss of G3BP2 sharply attenuated Wnt3a-stimulated β-catenin accumulation (Fig. 2B). G3BP2 knock-down also attenuated Wnt3a-stimulated Lef/Tcf-sensitive gene transcription (Fig. 2C). Wnt3a induces PE formation as made visible by positive staining of cytokeratin endoA, a hallmark for PE formation (Liu et al., 2002; Bikkavilli et al., 2008a; Bikkavilli and Malbon, 2010). Loss of G3BP2 abolished Wnt3a-induced PE formation (Fig. 2D). G3BP1 isoform was shown earlier to regulate β-catenin mRNA (Bikkavilli and Malbon, 2011). We probed next if G3BP2 also could modulate β-catenin mRNA levels. Unlike the inhibitory effects on Wnt-stimulated β-catenin, Lef/Tcf-sensitive gene transcription and PE formation, loss of G3BP2 resulted in elevated β-catenin mRNA levels (Fig. 2E). We also tested if G3BP2, similar to its G3BP1 isoform (Bikkavilli and Malbon, 2011), could bind β-catenin mRNA in vitro using northwestern blotting (Fig. 2F). Digioxigenein (DIG)-labeled 3‟-β-catenin untranslated region (UTR) probe displayed binding to both the G3BPs (Fig. 2F). These observations suggest an important role for G3BP2 in Wnt/β-catenin signaling.

6

G3BP2 is methylated in response to Wnt3a treatment The C-terminus of G3BP2 displays glycine arginine-rich (GAR) motifs. Such GAR motifs are prominent targets for protein arginine methyl transferases [PRMTs, (Bedford and Richard, 2005; Bedford, 2007; Bedford and Clarke, 2009; Lee and Stallcup, 2009)], so we characterized the expression profile of PRMTs (PRMT 1-8) in F9 cells. Reverse transcription-polymerase chain


Accepted manuscript

reaction (RT-PCR) of mouse total RNA with PRMT specific primers revealed the expression of five PRMTs: 1, 2, 5, 7 and 8 (Fig. 3A). The expressed PRMTs are classified as type I (PRMT1 and 8), type II (PRMT5 and 7) and type IV (PRMT2), based on their abilities to catalyze either symmetric or asymmetric di-methyl arginine formation (Bedford, 2007). We cloned the expressed PRMTs into tagged expression vectors (pCMV-HA) to interrogate if PRMTs could interact and/or methylate G3BP2. HA-tagged PRMTs then were expressed in F9 cells; wholecell lysates were probed for PRMT-G3BP2 interaction using pull-downs (Fig. 3B). HA-affinity pull-downs revealed a specific interaction of G3BP2 with four PRMTs (1, 2, 7 and 8, Fig. 3B). We tested if PRMTs 1, 2, 7 and 8 catalyze G3BP2 methylation (Fig. 3C). Using PRMTs purified from F9 cells and recombinant G3BP2 (rG3BP2) isolated from E. coli, in vitro methylation was assayed in the presence of the methyl donor, [3H]-S-adenosyl L-methionine (SAM, Fig. 3C). PRMTs 1, 7 and 8 each readily catalyzed G3BP2 methylation (Fig. 3C). Remarkably, despite an ability to bind G3BP2, PRMT2 failed to catalyze G3BP2 methylation (Fig. 3C). We extended these findings on G3BP2 methylation in vivo, using metabolic labeling of cells with [3H]-L-methyl methionine (Fig. 3D). Cells transiently transfected with either pCMV-Myc or Myc-G3BP2 and metabolic labeled were probed by pull-downs. Anti-myc antibodies pull-downs, SDS-PAGE, and fluorography demonstrated methylation of G3BP2 and increased methylation of G3BP2 in the presence of Wnt3a (Fig. 3D). 7

G3BP2 regulates LRP6 phosphorylation We interrogated a role for G3BP2 at the most proximal point of Wnt signaling, LRP6 phosphorylation. Expression of LRP6∆N (LRP6 lacking most of its extracellular domain) has been shown to stimulate β-catenin stabilization and Lef/Tcf-sensitive gene transcription (Brennan et al., 2004; Tamai et al., 2004; Zeng et al., 2005). Expression of LRP6∆N indeed

Accepted manuscript

down of G3BP2 was found to attenuate LRP6∆N-induced Lef/Tcf-sensitive gene activation (Fig.


induced robust Lef/Tcf-sensitive gene transcription, as does Wnt3a alone (Fig. 4A). Knock-

could modulate LRP6 activation via protein phosphorylation. The phosphorylation of LRP6 was

4A). Knock-down of G3BP2 strongly suppressed Wnt3a complimented LRP6∆N action (Fig. 4A), suggesting G3BP2 regulation of Wnt3a action via LRP6. Wnt3a stimulation has been shown to catalyze robust LRP6 (Ser1490) phosphorylation (Tamai et al., 2004; Zeng et al., 2005; Bilic et al., 2007; Pan et al., 2008). We probed if G3BP2

ascertained by making use of phospho-LRP6 (Ser1490)-specific antibodies (Fig. 4B). Knockdown of G3BP2 (Fig. 4B), but not that of G3BP1 (Fig. 4C), was found to sharply suppress the ability of Wnt3a to induce LRP6 phosphorylation (Fig. 4B). Wnt3a-stimulated LRP6 phosphorylation: role of PRMTs If a link between protein methylation and LRP6 phosphorylation existed, we could probe it using methyl transferase specific inhibitors. MTA [5‟-methylthioadenosine,(Avila et al., 2004; Cote and Richard, 2005), Fig. 4D] and Adox [adenosine, periodate oxidized, (Chen et al., 2004; Herrmann et al., 2005), (Fig. 4E)] are potent methyl transferase specific inhibitors. We pretreated cells with either MTA or Adox and used Wnt3a-stimulated LRP6 phosphorylation as a read-out. MTA effectively blocked LRP6 phosphorylation in response to Wnt3a (Fig. 4D). 8

Treating cells with Adox acted similarly on LRP6 phosphorylation (Fig. 4E). A role for protein methylation in Wnt3a-induced LRP6 phosphorylation was clear (Fig. 4 D, E). We ascertained if methylation of G3BP2 specifically was essential for phosphorylation of LRP6. Based on similarity with G3BP1 isoform (Bikkavilli and Malbon, 2011) and published literature (Ong et al., 2004), a panel of methylation-deficient mutants of G3BP2 were created.

Accepted manuscript

later employed to probe the full set of possibilities. Expression of two G3BP2 mutants, R432K


The mutants (Fig. 1A, R-K substitutions, R418K, R432K, R438K, R452K, R457K, R468K) were

To interrogate how G3BP2 might modulate protein kinases acting on LRP5/6, we made

and R452K, were found to attenuate Wnt3a-induced LRP6 phosphorylation (Fig. 4F). Expression of either R418K or R457K mutants, in contrast, yielded only a small decrease in Wnt3a-induced LRP6-phosphorylation (Fig. 4F). Expression of R438K or R468K mutants of G3BP2, in contrast, showed no apparent effects on LRP6-phosphorylation (Fig. 4F).

use of GSK3β over expression. Over expression of GSK3β stimulates LRP6 (Ser1490) phosphorylation [Fig. 4G, (Zeng et al., 2005)]. Expression of G3BP2 strongly suppressed GSK3β-stimulated LRP6 (Ser1490) phosphorylation (Fig. 4G). G3BP2 appears to modulate GSK3β-mediated LRP6 phosphorylation (Fig. 4G). The G3BP2-Dishevelled interaction is methylation-dependent We were keenly interested to probe if G3BP2 methylation impacts Dvl3-G3BP2 association (Fig. 5A). Cells expressing wild-type (WT) or methylation-deficient mutants (R-K substitutions) of G3BP2 were employed in pull-down assays of Dvl3-based supermolecular complexes (Fig. 5A). Wnt3a-stimulation was found to increase the association of both WT and the R418K mutant of G3BP2 into Dvl3-based complexes (Fig. 5A). Expression of R432K, R438K, R452K or 9

R468K mutants of G3BP2, in sharp contrast, attenuates Wnt3a-stimulated association of G3BP2 with Dvl3-based complexes (Fig. 5A). Methylation of G3BP2 (at R432, R438, R452 or R468) appears indispensable to proper assembly of G3BP2 into Dvl3-based complexes in response to Wnt3a (Fig. 5A). Expression of methylation-deficient mutants of G3BP2 block Wnt/β-catenin signaling


Accepted manuscript

Would expression of G3BP2 mutants unable to form proper Dvl3-based complexes impact Wnt3a activation of Lef/Tcf-sensitive gene expression? Expression of R432K and R452K mutants of G3BP2 suppressed the ability of Wnt3a to stimulate Lef/Tcf-sensitive gene transcription (Fig. 5B). Expression of WT or R457K mutant of G3BP2, in contrast, showed no effect on Wnt3a action (Fig. 5B). Expression of R418K mutant actually showed a slight increase in Wnt3a-stimulated Lef/Tcf-sensitive gene expression (Fig. 5B). G3BP2 mutant expression was probed in SW480 cells also. SW480 cells (derived from adenocarcinoma of colon) display high levels of β-catenin (Sinner et al., 2007). Expression of four of the same mutants (R432K, R438K, R452K and R468K) in SW480 cells effectively suppressed Lef/Tcf-sensitive gene transcription (Fig. 5C). Expression of R418K and R457K, like WT, stimulated Lef/Tcf-sensitive gene transcription (Fig. 5C). Finally, we performed gene rescue experiments to determine if G3BP2 methylation is critical for proper activation of Wnt signaling (Fig. 5G). For this purpose we have constructed a siRNA-resistant G3BP2 construct by engineering silent mutations (underscored) within the siRNA target site (gggagagagtttgtacgccaatatt). Depletion of G3BP2 (as shown earlier, Fig. 2C) suppressed Wnt-stimulated Lef/Tcf-sensitive gene transcription (Fig. 5D). Only G3BP2 cDNAs that were resistant to siRNA treatment, but not either the methylation-deficient mutant of siRNA-

10

resistant G3BP2 (R432K, R452K and R468K) or that of G3BP1, rescued Wnt-stimulated Lef/Tcf-sensitive gene transcription in G3BP2-depleted cells (Fig. 5D). Clearly, G3BP2


Accepted manuscript

methylation mediates regulation of Wnt signaling.

11

Discussion Wnt induces robust LRP6 phosphorylation. Several kinases, most importantly GSK3β, have been reported to phosphorylate LRP6 on a PPPS/TP motif (Tamai et al., 2004; Zeng et al., 2005; Bilic et al., 2007; Pan et al., 2008; Cervenka et al., 2011). We reveal a novel role for protein arginine methylation in regulating LRP6 phosphorylation as well as an unanticipated role for G3BP2 in

Accepted manuscript

evolved from sequence homology with G3BP1 (Irvine et al., 2004). G3BP1 and G3BP2 display


regulation of LRP6 phosphorylation and Wnt/β-catenin signaling. The identification of G3BP2

In the current work, G3BP2 is shown to be a positive regulator of Wnt signaling. G3BP2

60% identity in protein sequences, encode an N-terminal nuclear transport factor 2-like domain, an RNA recognition motif (RRM), and glycine arginine rich motifs [RGG, (Irvine et al., 2004)]. Despite high homology at the protein level, G3BP1 and 2 are not functionally redundant i.e., lost function of G3BP2 cannot be rescued by G3BP1expression (Fig. 5D).

acts at the level of LRP6 phosphorylation by modulating the activity of GSK3β (Fig. 4). Wnt3a stimulates G3BP2 methylation (Fig. 3). In addition, Wnt3a-stimulated LRP6 phosphorylation is shown to be sensitive to chemical inhibition of methyl transferase activity as well as to expression of methylation-deficient mutants of G3BP2 (Fig. 4), revealing a novel and an important link between arginine methylation and LRP6 phosphorylation. Furthermore, like the G3BP1 isoform (Bikkavilli and Malbon, 2011), G3BP2 also regulates β-catenin mRNA levels. Unlike G3BP1 depletion, which results in a concurrent increase in both the mRNA and protein levels of β-catenin, G3BP2 depletion provokes elevated β-catenin mRNA (Fig. 2). These observations suggest that G3BP2, in addition to regulating LRP6 phosphorylation, might also play an important role in β-catenin mRNA regulation, the details of which remain obscure. The role of G3BP2 methylation is not limited to such results, G3BP2 and PRMTs are frequently 12

over-expressed in many human tumors (Guitard et al., 2001; Liu et al., 2001; French et al., 2002; Mathioudaki et al., 2008). Dysfunctional G3BP2 methylation may play a key role in specific disease states [Hela cells, R457 and R468, (Ong et al., 2004)]. Over expression of wild-type G3BP2 provoked a modest decrease in Wnt3a-induced LRP6 phosphorylation (Fig. 4F), with no significant decrease in Wnt3a-induced Lef/Tcf-


Accepted manuscript

sensitive gene transcription (Fig. 5 B,C). We proffer that over expression of G3BP2 may not induce a corresponding increase in Wnt3a-stimulated methylation of G3BP2 by PRMTs (as PRMTs themselves were not over expressed). Wnt3a-dependent G3BP2 methylation may be affecting more than one Wnt-sensitive read-outs. Differential sensitivities of the read-outs to G3BP2 methylation best explain the observed differences in effects upon Wnt-stimulated LRP6 phosphorylation versus Lef/Tcf-sensitive transcription. Dishevelleds display conserved domains (DIX, PDZ, and DEP) and C-termini that constitute docking sites for many proteins (Malbon and Wang, 2006; Gao and Chen, 2010). In vivo, Dvls appear as either large aggregates or polymers (Schwarz-Romond et al., 2007). These supermolecular size complexes ( Mr > 5-10 MDa) shift to higher Mr in response to Wnt stimulation (Yokoyama et al., 2010). We report herein a link between arginine methylation and assembly of Dvl3-based complexes. G3BP2 itself is shown to be a novel Dvl3-associated protein (Fig. 1). Wnt3a stimulation induces rapid recruitment of G3BP2 into Dvl3-based complexes. G3BP2 association to Dvl3-based complexes is also methylation-sensitive (Fig. 5A). Methylation of G3BP2 at R432, R438, R452 and R468 are critical not only for G3BP2 docking onto Dvl3, but also for proper activation of Wnt/β-catenin signaling. G3BP2 methylation at R432 and R452, in contrast, were sufficient for Wnt-stimulated LRP6 phosphorylation. Methylation of G3BP2 at R438 and R468 might play a role in β-catenin mRNA regulation. The effects of 13

methylation-deficient mutants in SW480 cells also support this hypothesis. In addition, roles of LRP6 phosphorylation on β-catenin mRNA regulation are deserving of in depth study and cannot be dismissed prematurely. Furthermore, methylation of arginine residues flanking proline-rich motifs has been shown to alter binding by SH3 domains (Bedford et al., 2000; Bedford, 2007). Interestingly, R432 and R438 of G3BP2, critical for Dvl3 binding, LRP6 phosphorylation, and Lef/Tcf-sensitive gene transcription, display a flanking PXXP motif


Accepted manuscript

(RGPGGPRG). LRP6 (Ser1490) phosphorylation by GSK3β triggers Axin recruitment to the membrane (Tamai et al., 2004; Zeng et al., 2005; Bilic et al., 2007; Pan et al., 2008). Dvls play a critical role in trafficking Axin to the cell membrane (Bilic et al., 2007). Earlier, Cytoplasmic activation/proliferation-associated protein 2 (Caprin-2) was shown to regulate LRP5/6 action through recruitment of Axin to LRP5/6 (Ding et al., 2008). In the current study, we also identified several peptides of Caprin in both Dvl3-based as well as G3BP2-based complexes (data not shown). Therefore we proffer that the G3BP2-based complex which includes Caprin might well regulate LRP6 phosphorylation by G3BP2-regulated GSK3β-mediated phosphorylation, and/or Caprin-mediated Axin recruitment to the membrane (Fig. 6). In any case, we reveal arginine methylation as a novel regulator of Wnt3a-stimulated LRP6 phosphorylation. Wnt3a activates methylation of G3BP2 and recruitment of methylated-G3BP2 into Dishevelled-based supermolecular complexes. The Dvl3-G3BP2 complex later promotes GSK3β-catalyzed phosphorylation of LRP6 on Ser1490. Thus arginine methylation of G3BP2 is revealed as a key element in Wnt/β-catenin signaling.

14

Materials and Methods Constructs Mouse Dvl3 isoform was engineered in-house with GFP2 and HA tags. Mouse G3BP2 was amplified from cDNAs of F9 cells and was subcloned into the pCMV-Myc plasmid in frame with Myc tag sequence. Site directed mutagenesis was performed on Myc-G3BP2 plasmid using

Accepted manuscript

Quick Change Site Directed Mutagenesis kit (Stratagene) to obtain Myc-G3BP2 mutants (R418K, R432K, R438K, R452K, R457K, and R468K). For generating GST tagged G3BP2, G3BP2 was subcloned into pGEX4T1 plasmid in frame with the GST protein. For constructing siRNA-resistant G3BP2, silent mutations were engineered into the siRNA target site (mutated bases are underscored, gggagagagtttgtacgccaatatt) by using Site Directed Mutagenesis kit, as described above. Myc-G3BP1 and pCDNA3.1-mβ-catenin 3‟-UTR were generated as described


earlier (Bikkavilli and Malbon, 2011). Mouse PRMTs were also amplified from cDNAs of F9 cells and were subcloned into pCMV-HA vector in frame with HA tag sequence. The primers used for cloning are summarized in Table 1. Cell culture Mouse F9 teratocarcinoma cell stocks were obtained from ATCC (Manassas, VA) and were maintained in Dulbecco‟s modified Eagle‟s medium (DMEM) supplemented with 15% heat inactivated fetal bovine serum (Hyclone, South Logan, UT) at 37 oC in a 5% CO2 incubator. The F9 cells stably expressing Rfz1 and pTOPFLASH (M50) luciferase reporter (Rfz1) were generated as described earlier (Bikkavilli et al., 2008b) and employed as a standard in all the experiments. The use of this stable cell line as the starting point for transient transfections reduced variability and offered greater consistency by reducing the number of plasmids required

15

for simultaneous transfections. Human embryonic kidney 293 cells (HEK) were also obtained from ATCC and were maintained in DMEM supplemented with 10% FBS. SW480 cells were obtained from ATCC and were maintained in L15 medium (Mediatech) supplemented with 10% FBS, at 37 oC in air (100%). Co-immunoprecipitation and immunoblotting


Accepted manuscript

For co-immunoprecipitation experiments, F9 clones stably expressing Rfz1were transiently transfected for 24 hours with 6 µg of plasmid vectors in 100 mm culture dishes. After 24 hours, the cells were lysed in 1 ml of lysis buffer (20 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton-X-100, 2.5 mM Na4P2O7, 1 mM β-glycerophosphate, 1 mM Na3VO4, 1 µg/ml leupeptin, 1 µg/ml aprotonin and 1 µg/ml phenylmethylsulphonyl fluoride). The lysates were cleared by centrifugation at 20,000 x g for 15 minutes, twice. The supernatants were transferred into new tubes and protein concentrations were determined by Lowry method (Lowry et al., 1951). Immunoprecipitations were performed using either rat anti-HA high affinity (Roche), mouse-monoclonal anti-Dvl3 (sc 8027, santa cruz), mouse-monoclonal anti-myc antibodies (M4439, Sigma, St Louis, MO), and protein-G resin (L00209, GenScript, Piscataway, New Jersey). For LRP6 phosphorylation assays, the cells were lysed in a lysis buffer (137 mM NaCl, 20 mM Tris (pH 8.0), 100 mM NaF, 10 mM Na2MoO4, 10% glycerol, 1 mM Na2VO4, 1% NP40). For immunoblotting, total lysates (30-60 μg of protein/lane) were subjected to electrophoresis in 8% SDS-PAGE gels. The resolved proteins were transferred electrophoretically to nitrocellulose membrane “blots”. The blots were incubated with primary antibodies overnight at 4 oC and the immunocomplexes were made visible by use of a secondary antibody coupled to horseradish peroxidase and developed using the enhanced chemiluminescence method. The antibodies were purchased from the following sources: anti-HA 16

high affinity antibody (Roche Applied Science, Indianapolis, IN), anti-β-catenin, anti-myc, and anti-β-actin antibodies were from Sigma-Aldrich (St. Louis, MO). Phospho-LRP6 (Ser1490) Antibody (#2568) was from Cell Signaling technology. Anti-LRP6 antibody (sc15399) was from Santa Cruz biotechnology. In vitro methylation assays


Accepted manuscript

In vitro methylation assay using bacterially expressed GST-G3BP2 was performed as described earlier (Bikkavilli and Malbon, 2011). Briefly, F9 cells were transiently transfected with HAPRMT1, 2, 5, 7 and 8 (6 µg) in 100 mm culture dishes. After 24 hours of transfection, the cells were lysed in a lysis buffer (20 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton-X-100, 2.5 mM Na4P2O7, 1 mM β-glycerophosphate, 1 mM Na3VO4, 1 µg/ml leupeptin, 1 µg/ml aprotonin and 1 µg/ml phenylmethylsulphonyl fluoride). PRMTs from the lysates were immunoprecipitated with anti-HA antibodies and protein-G resin (L00209, GenScript, Piscataway, New Jersey). After 16 h, the immunoprecipitates were washed thrice in RIPA buffer [20 mM Tris (pH 8.0), 150 mM NaCl, 5 mM EDTA and 1% Triton-X-100] and once in methylation buffer (50 mM Tris pH 8.5, 20 mM KCl, 10 mM MgCl2, 1 mM β-mercaptoethanol, 100 mM Sucrose). Finally, the bound PRMTs were incubated with 15 µl of methylation reaction buffer containing 4 µg of GST-G3BP2 and 1 µCi of S-adenosyl-L-[methyl-3H] methionine (NEN radiochemicals, 250 µCi, 9.25 MBq), at 30 oC for 1 h. After 1 hour, the reactions were stopped by addition of 5 µl 6x SDS sample loading buffer, boiled and separated on a SDS-PAGE gel. Proteins on the gel were transferred onto nitrocellulose membranes using semi-dry transfer, amplified (Autofluor, National Diagnostics, 2 hours), and fluorography was performed. In vivo methylation assays

17

In vivo methylation assay for G3BP2 was performed as described earlier (Bikkavilli and Malbon, 2011). Briefly, F9 cells were transiently transfected with pCMV-Myc, or Myc-G3BP2 (6 µg) in 100 mm culture dishes and grown to confluency (24 h). After 24 hours, the cells were washed once with PBS and protein translation was inhibited by treatment with 100 µg/ml cycloheximide and 40 µg/ml chloramphenicol in DMEM medium with 10% FBS for 30 min at 37 oC. After 30 min, the cells were washed once with methionine free DMEM. Cell labeling mixture consisting


Accepted manuscript

of methionine free DMEM supplemented with 100 µg/ml cycloheximide and 40 µg/ml chloramphenicol and 60 µCi of L-[methyl-3H] methionine was added to the cells in the absence or presence of Wnt3a (10 ng/ml) and incubated at 37oC for 3 hours. After 3 hours, the cells were lysed in a lysis buffer (1x PBS, 1% Nonidet P-40, 0.5% Sodium deoxycholate, 0.1% SDS, 1 µg/ml leupeptin, 1 µg/ml aprotonin and 1 µg/ml phenylmethylsulphonyl fluoride). Immunoprecipitations were performed on the lysates using anti-myc antibodies and protein-A sepharose CL-4B (17-0780-01, GE Life Sciences) for 16 hours at 4 oC. After 16 hours, the immunoprecipitates were washed thrice in RIPA buffer [20 mM Tris (pH 8.0), 150 mM NaCl, 5 mM EDTA and 1% Triton-X-100] and the beads were resuspended in 2x SDS sample loading buffer, boiled and separated on a SDS-PAGE gel. The gel was then transferred to a nitrocellulose membrane, amplified (Autofluor, National Diagnostics, 2 h), and fluorography was performed. Cytosolic β-catenin accumulation assay To separate the cytosolic β-catenin from membrane associated β-catenin, lysates were treated with concanavalin A sepharose (Con A, GE life sciences), as described earlier (Aghib and McCrea, 1995). Briefly, confluent F9 cultures were treated with Wnt3a for 4 hours (Figure 3, panels B, E, F) and lysed in a lysis buffer (20 mM Tris pH 7.4, 150 mM NaCl, 5 mM EDTA, 50 mM NaF, 40 mM Na4P2O7, 50 mM K2HPO4, 10 mM Na2MoO4, 2 mM Na3VO4, 1%, Triton-X18

100, 0.5% NP40, 1 µg/ml leupeptin, 1 µg/ml aprotonin and 1 µg/ml phenylmethylsulphonyl fluoride). The lysates were transferred into 1.5 ml Eppendorf tubes and rotated at 4 oC for 15 minutes followed by centrifugation at 20,000 x g for 15 minutes. The supernatants were transferred into new tubes, their protein concentrations were determined and the concentration was adjusted to 2.5 mg/ml with lysis buffer. Sixty microliters of Con A sepharose was added to each tube and rotated at 4 oC for 1 hour. After a brief centrifugation, the supernatants were


Accepted manuscript

transferred to new tubes and 30 µl of Con A sepharose was added to each tube and rotated at 4 o

C for another hour. Finally, after a brief centrifugation, the supernatants were transferred to new

tubes and their protein concentration was determined. β-catenin accumulation was analyzed by probing the blots with anti-β-catenin antibodies and normalized by probing the same blots with anti-actin antibodies. Knock-down protocol Double-stranded RNAs (siRNAs) targeting mouse G3BP2 (5‟GGGCGGGAGUUUGUGAGGCAAUAUU-3‟), mouse G3BP1 (5‟CCAAGAUGAGGUCUUCGGUGGCUUU-3‟) and control siRNAs (5‟UCUGUGAUUUGAAAGACUAGCCAAG-3‟) were procured from Invitrogen (Invitrogen, Carlsbad, CA). F9 cells expressing Rfz1 were treated with 100 nM siRNAs by using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer‟s protocol. Briefly, 100 nM siRNAs were incubated with 5 μl Lipofectamine 2000 for 20 minutes in 200 μl Optimem medium (Invitrogen, Carlsbad, CA), and the mixture was then added into 1ml of growth medium in a 12-well plate in which F9 cells expressing Rfz1 were cultured to 80% confluency. After siRNA treatment for 48 hours the cells were assayed for β-catenin mRNA,

19

cytosolic β-catenin stabilization, LRP6 phosphorylation, Lef/Tcf-sensitive gene transcription or PE formation. For gene rescue experiments, RFz1 cells were treated with 100 nM siRNAs for 4 hours. After 4 hours, the siRNA complexes were removed and fresh DMEM medium supplemented with 20% FBS were added. After an additional 18 hours, the G3BP2-depleted cells were


Accepted manuscript

transfected with pCMV-Myc, siRNA-resistant G3BP2, methylation deficient mutant of siRNAresistant G3BP2, or Myc-G3BP1 using lipofectamine and plus reagents as suggested by the manufacturer. After 24 hours, the cells were treated with Wnt3a (25 ng/ml) for 7 hours and the lysates were assayed for Lef/Tcf-dependent luciferase activities. The luciferase activities of cells treated with control siRNA and stimulated with Wnt3a were considered as 100% to determine the percent reduction in luciferase activities of G3BP2 siRNA treated cells and are represented in the Figure. Lef/Tcf transcription assays F9 cells stably expressing Rfz1 and super 8xTOPFLASH (M50) luciferase reporter were seeded into 12-well plates. Following incubation with control or G3BP2 specific siRNAs for 48 hours, the cells were treated with or without recombinant Wnt3a for 7 hours (R&D systems, Minneapolis). Cells were then directly lysed on the plates by addition of 1x cell culture lysis reagent (Promega, Madison, WI). Lysates were collected into chilled microfuge tubes on ice and centrifuged at 20,000 x g for 5 minutes. The supernatant was transferred into a new tube and directly assayed as described below. Twenty microliters of the lysate was mixed with 100 µl of luciferase assay buffer (20 mM Tricine, pH 7.8, 1.1 mM MgCO3, 4 mM MgSO4, 0.1 mM EDTA, 0.27 mM coenzyme A, 0.67 mM luciferin, 33 mM DTT, and 0.6 mM ATP) and the luciferase

20

activities were measured with a luminometer (Berthold Lumat LB 9507). The samples were assayed in triplicate and the luciferase activities were normalized by protein content of the samples and are represented in the figures. Indirect immunofluorescence F9 cells stably expressing Rfz1 were transfected with either control siRNAs or G3BP2 siRNAs


Accepted manuscript

as described earlier. After 24 hours, the cells were re-seeded into 24-well plates, incubated at 37 o

C for 4 hours, followed by stimulation with Wnt3a (day 1). On day 2, the cells were given a

second siRNA treatment followed by Wnt3a treatment. Finally, after the treatment of the cells with Wnt3a on days 3 and 4, the cells were fixed with 3% paraformaldehyde at room temperature for 5 minutes, followed by three washes with MSM-PIPES buffer (18 mM MgSO4, 5 mM CaCl2, 40 mM KCl, 24 mM NaCl, 5 mM PIPES, 0.5% Triton X-100, 0.5% NP40). The cells were then incubated with the TROMA-1 antibody (Developmental Studies Hybridoma Bank, Univeristy of Iowa) at 37 oC for 30 minutes. After three washes with MSM-PIPES buffer, the cells were incubated with an anti-mouse antibody coupled to Alexa Fluor 488 (Invitrogen) at 37 oC for 30 minutes. Finally, the cells were washed in blotting buffer (560 mM NaCl, 10 mM KH2PO4, 0.1% Triton X-100, 0.02% SDS) and images were captured using a Zeiss LSM510 inverted fluorescence microscope. Northwestern analysis Digioxigenin (Dig)-labeled 3‟-UTR probes of β-catenin were synthesized in vitro using T7 RNA polymerase (Roche applied sciences) as per the manufacturer‟s recommendations in the presence of rNTPs and Dig-UTP and pcDNA3.1vectors harboring β-catenin UTR as a template. For northwestern analysis, immunoprecipitated proteins were resolved on SDS-PAGE gels and 21

electrophoretically transferred to nitrocellulose membranes „blots‟. The blots were blocked in Tris buffered saline (TBST, 50 mM Tris pH 7.4, 150 mM NaCl and 0.1% Tween 20) containing 5% not-fat milk at 4 oC overnight with gentle rocking. Dig-labeled probes (1 µg/ml in TBST buffer with milk) were added to the blots and incubated at room temperature with gentle rocking for 2 h. After 2 h, the blots were washed thrice in TBST at 5 min intervals. The binding of RNA probes to G3BP1 was then revealed by probing the blots with anti-Dig AP fragments diluted


Accepted manuscript

(1:1000) in TBST with 5% milk (11093274910, Roche applied science), followed by colorimetric detection of alkaline phosphatase using Nitro-Blue Tetrazolium Chloride (NBT) and 5-Bromo-4-Chloro-3'-Indolyphosphate p-Toluidine Salt (BCIP) substrates according to the manufacturer‟s recommendation (Roche DIG-RNA detection kit, Roche). RNA isolation and RT-PCR Total RNA from F9 cells treated with either control siRNAs or G3BP2 specific siRNAs were isolated using RNA STAT 60 reagent (Tel-test Inc. Friendswood, Texas, USA) according to the manufacturer‟s instructions. After determining the RNA concentrations using a spectrophotometer, first strand cDNA synthesis was performed using 250 ng of total RNA and Superscript II reverse transcriptase (Invitrogen) and random primer hexamers. Real-time quantitative PCR amplification was performed using the DNA engine Opticon continuous fluorescence detection system (MJ research Inc, Boston, MA). For a 20 µl PCR, 8 µl of cDNA template (previously diluted to 1:15 with water) was mixed with 6.25 pmol of forward and reverse primers and 2x SYBR green PCR master mix (Qiagen, Valencia, CA). The Light Cycler was programmed such that it included an initial activation step of 95 oC for 15 minutes followed by 40 cycles of denaturation at 95 oC for 30 seconds, annealing at 60 oC for 30 seconds and extension at 72 oC for 1 minute. Each cDNA sample was analysed in triplicates and the absolute 22

amounts of β-catenin template in the immunocomplexes were determined using an external standard. Briefly, a standard curve was generated using cycle threshold (Ct) values obtained from real-time PCR using Dvl2 specific primers (Table 1) and pGFP2-N2-mDvl2 plasmid (1, 0.1, 0.01 and 0.001 ng/reaction). The Ct values of real-time PCR for cDNA from each RNA sample was then substituted in the equation generated from the corresponding standard curve to calculate the amount of the amplicon. The fold increase over control values are represented in the


Accepted manuscript

graph. Data analysis Data were compiled from at least three independent, replicate experiments, each performed on separate cultures and on separate occasions. The responses are displayed as “fold-changes” (over the untreated control). Comparisons of data among experimental groups were performed using student‟s t-test for assessing variance. Statistical significance (p value of <0.05) is denoted with either an “asterisk” or a “pound” symbol. The indirect immunofluorescence and phase contrast images are of representative fields.

23

Acknowledgments


Accepted manuscript

We thank Dr. Antonius Koller (Technical Director, Proteomics Center, SUNY, Stony Brook) for his help with sample preparation and generation and analysis of MS/MS spectra. We thank Dr. Xi He (Children's Hospital, Boston) for the generous gift of LRP6∆N expression vector, Dr. Randall T. Moon (University of Washington, Seatle) for the generous gift of RFz1 and M50 expression vectors and Dr. Jim Woodget (Mount Sinai Hospital, Canada) for the generous gift of pcDNA-HA-hGSK3β. We would also like to thank Drs. Hsien-Yu Wang and Nedialka Markova for critical reading of the manuscript. We also thank members of the Malbon and Wang laboratories for their critical comments and helpful suggestions. This work is supported by USPHS Grant DK30111 from the NIDDK, National Institutes of Health (to CCM).

24


Accepted manuscript

References: 1. Aghib, D. F. and McCrea, P. D. (1995). The E-cadherin complex contains the src substrate p120. Exp Cell Res 218, 359-369. 2. Angers, S. and Moon, R. T. (2009). Proximal events in Wnt signal transduction. Nat Rev Mol Cell Biol 10, 468-477. 3. Avila, M. A., Garcia-Trevijano, E. R., Lu, S. C., Corrales, F. J. and Mato, J. M. (2004). Methylthioadenosine. Int J Biochem Cell Biol 36, 2125-2130. 4. Bedford, M. T. (2007). Arginine methylation at a glance. J Cell Sci 120, 4243-4246. 5. Bedford, M. T. and Richard, S. (2005). Arginine methylation an emerging regulator of protein function. Mol Cell 18, 263-272. 6. Bedford, M. T. and Clarke, S. G. (2009). Protein arginine methylation in mammals: who, what, and why. Mol Cell 33, 1-13. 7. Bedford, M. T., Frankel, A., Yaffe, M. B., Clarke, S., Leder, P. and Richard, S. (2000). Arginine methylation inhibits the binding of proline-rich ligands to Src homology 3, but not WW, domains. J Biol Chem 275, 16030-16036. 8. Behrens, J., von Kries, J. P., Kuhl, M., Bruhn, L., Wedlich, D., Grosschedl, R. and Birchmeier, W. (1996). Functional interaction of beta-catenin with the transcription factor LEF1. Nature 382, 638-642. 9. Bikkavilli, R. K. and Malbon, C. C. (2010). Dishevelled-KSRP complex regulates Wnt signaling through post-transcriptional stabilization of beta-catenin mRNA. J Cell Sci 123, 13521362. 10. Bikkavilli, R. K. and Malbon, C. C. (2011). Arginine methylation of G3BP1 in response to Wnt3a regulates {beta}-catenin mRNA. J Cell Sci 124, 2310-2320. 11. Bikkavilli, R. K., Feigin, M. E. and Malbon, C. C. (2008a). p38 mitogen-activated protein kinase regulates canonical Wnt-beta-catenin signaling by inactivation of GSK3beta. J Cell Sci 121, 3598-3607. 12. Bikkavilli, R. K., Feigin, M. E. and Malbon, C. C. (2008b). G alpha o mediates WNT-JNK signaling through dishevelled 1 and 3, RhoA family members, and MEKK 1 and 4 in mammalian cells. J Cell Sci 121, 234-245. 13. Bilic, J., Huang, Y. L., Davidson, G., Zimmermann, T., Cruciat, C. M., Bienz, M. and Niehrs, C. (2007). Wnt induces LRP6 signalosomes and promotes dishevelled-dependent LRP6 phosphorylation. Science 316, 1619-1622. 14. Binnerts, M. E., Tomasevic, N., Bright, J. M., Leung, J., Ahn, V. E., Kim, K. A., Zhan, X., Liu, S., Yonkovich, S., Williams, J. et al. (2009). The first propeller domain of LRP6 regulates sensitivity to DKK1. Mol Biol Cell 20, 3552-3560. 15. Brennan, K., Gonzalez-Sancho, J. M., Castelo-Soccio, L. A., Howe, L. R. and Brown, A. M. (2004). Truncated mutants of the putative Wnt receptor LRP6/Arrow can stabilize beta-catenin independently of Frizzled proteins. Oncogene 23, 4873-4884. 16. Brott, B. K. and Sokol, S. Y. (2002). Regulation of Wnt/LRP signaling by distinct domains of Dickkopf proteins. Mol Cell Biol 22, 6100-6110. 17. Cervenka, I., Wolf, J., Masek, J., Krejci, P., Wilcox, W. R., Kozubik, A., Schulte, G., Gutkind, J. S. and Bryja, V. (2011). Mitogen-activated protein kinases promote WNT/betacatenin signaling via phosphorylation of LRP6. Mol Cell Biol 31, 179-189. 18. Chen, D. H., Wu, K. T., Hung, C. J., Hsieh, M. and Li, C. (2004). Effects of adenosine dialdehyde treatment on in vitro and in vivo stable protein methylation in HeLa cells. J Biochem 136, 371-376. 25

Accepted manuscript Journal of Cell Science

19. Cote, J. and Richard, S. (2005). Tudor domains bind symmetrical dimethylated arginines. J Biol Chem 280, 28476-28483. 20. Davidson, G., Wu, W., Shen, J., Bilic, J., Fenger, U., Stannek, P., Glinka, A. and Niehrs, C. (2005). Casein kinase 1 gamma couples Wnt receptor activation to cytoplasmic signal transduction. Nature 438, 867-872. 21. Ding, Y., Xi, Y., Chen, T., Wang, J. Y., Tao, D. L., Wu, Z. L., Li, Y. P., Li, C., Zeng, R. and Li, L. (2008). Caprin-2 enhances canonical Wnt signaling through regulating LRP5/6 phosphorylation. J Cell Biol 182, 865-872. 22. French, J., Stirling, R., Walsh, M. and Kennedy, H. D. (2002). The expression of Ras-GTPase activating protein SH3 domain-binding proteins, G3BPs, in human breast cancers. Histochem J 34, 223-231. 23. Gao, C. and Chen, Y. G. (2010). Dishevelled: The hub of Wnt signaling. Cell Signal 22, 717727. 24. Guitard, E., Parker, F., Millon, R., Abecassis, J. and Tocque, B. (2001). G3BP is overexpressed in human tumors and promotes S phase entry. Cancer Lett 162, 213-221. 25. He, X., Semenov, M., Tamai, K. and Zeng, X. (2004). LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. Development 131, 1663-1677. 26. Herrmann, F., Lee, J., Bedford, M. T. and Fackelmayer, F. O. (2005). Dynamics of human protein arginine methyltransferase 1(PRMT1) in vivo. J Biol Chem 280, 38005-38010. 27. Irvine, K., Stirling, R., Hume, D. and Kennedy, D. (2004). Rasputin, more promiscuous than ever: a review of G3BP. Int J Dev Biol 48, 1065-1077. 28. Lee, Y. H. and Stallcup, M. R. (2009). Minireview: protein arginine methylation of nonhistone proteins in transcriptional regulation. Mol Endocrinol 23, 425-433. 29. Li, Y., Lu, W., King, T. D., Liu, C. C., Bijur, G. N. and Bu, G. (2010). Dkk1 stabilizes Wnt co-receptor LRP6: implication for Wnt ligand-induced LRP6 down-regulation. PLoS One 5, e11014. 30. Liu, T., Lee, Y. N., Malbon, C. C. and Wang, H. Y. (2002). Activation of the beta-catenin/LefTcf pathway is obligate for formation of primitive endoderm by mouse F9 totipotent teratocarcinoma cells in response to retinoic acid. J Biol Chem 277, 30887-30891. 31. Liu, Y., Zheng, J., Fang, W., You, J., Wang, J., Cui, X. and Wu, B. (2001). Identification of metastasis associated gene G3BP by differential display in human cancer cell sublines with different metastatic potentials G3BP as highly expressed in non-metastatic. Chin Med J (Engl) 114, 35-38. 32. Logan, C. Y. and Nusse, R. (2004). The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol 20, 781-810. 33. Lowry, O. H., Rosebrough, N. J., Farr, A. L. and Randall, R. J. (1951). Protein measurement with the Folin phenol reagent. J Biol Chem 193, 265-275. 34. MacDonald, B. T., Yokota, C., Tamai, K., Zeng, X. and He, X. (2008). Wnt signal amplification via activity, cooperativity, and regulation of multiple intracellular PPPSP motifs in the Wnt co-receptor LRP6. J Biol Chem 283, 16115-16123. 35. Malbon, C. C. (2005a). G proteins in development. Nat Rev Mol Cell Biol 6, 689-701. 36. Malbon, C. C. (2005b). Beta-catenin, cancer, and G proteins: not just for frizzleds anymore. Sci STKE 2005, pe35. 37. Malbon, C. C. and Wang, H. Y. (2006). Dishevelled: a mobile scaffold catalyzing development. Curr Top Dev Biol 72, 153-166.

26

Accepted manuscript Journal of Cell Science

38. Mathioudaki, K., Papadokostopoulou, A., Scorilas, A., Xynopoulos, D., Agnanti, N. and Talieri, M. (2008). The PRMT1 gene expression pattern in colon cancer. Br J Cancer 99, 20942099. 39. Molenaar, M., van de Wetering, M., Oosterwegel, M., Peterson-Maduro, J., Godsave, S., Korinek, V., Roose, J., Destree, O. and Clevers, H. (1996). XTcf-3 transcription factor mediates beta-catenin-induced axis formation in Xenopus embryos. Cell 86, 391-399. 40. Moon, R. T., Bowerman, B., Boutros, M. and Perrimon, N. (2002). The promise and perils of Wnt signaling through beta-catenin. Science 296, 1644-1646. 41. Niehrs, C. and Shen, J. (2010). Regulation of Lrp6 phosphorylation. Cell Mol Life Sci 67, 25512562. 42. Ong, S. E., Mittler, G. and Mann, M. (2004). Identifying and quantifying in vivo methylation sites by heavy methyl SILAC. Nat Methods 1, 119-126. 43. Pan, W., Choi, S. C., Wang, H., Qin, Y., Volpicelli-Daley, L., Swan, L., Lucast, L., Khoo, C., Zhang, X., Li, L. et al. (2008). Wnt3a-mediated formation of phosphatidylinositol 4,5bisphosphate regulates LRP6 phosphorylation. Science 321, 1350-1353. 44. Polakis, P. (2000). Wnt signaling and cancer. Genes Dev 14, 1837-1851. 45. Polakis, P. (2007). The many ways of Wnt in cancer. Curr Opin Genet Dev 17, 45-51. 46. Reya, T. and Clevers, H. (2005). Wnt signalling in stem cells and cancer. Nature 434, 843-850. 47. Schwarz-Romond, T., Fiedler, M., Shibata, N., Butler, P. J., Kikuchi, A., Higuchi, Y. and Bienz, M. (2007). The DIX domain of Dishevelled confers Wnt signaling by dynamic polymerization. Nat Struct Mol Biol 14, 484-492. 48. Semenov, M. V., Zhang, X. and He, X. (2008). DKK1 antagonizes Wnt signaling without promotion of LRP6 internalization and degradation. J Biol Chem 283, 21427-21432. 49. Sinner, D., Kordich, J. J., Spence, J. R., Opoka, R., Rankin, S., Lin, S. C., Jonatan, D., Zorn, A. M. and Wells, J. M. (2007). Sox17 and Sox4 differentially regulate beta-catenin/T-cell factor activity and proliferation of colon carcinoma cells. Mol Cell Biol 27, 7802-7815. 50. Tamai, K., Zeng, X., Liu, C., Zhang, X., Harada, Y., Chang, Z. and He, X. (2004). A mechanism for Wnt coreceptor activation. Mol Cell 13, 149-156. 51. Yokoyama, N., Golebiewska, U., Wang, H. Y. and Malbon, C. C. (2010). Wnt-dependent assembly of supermolecular Dishevelled-3-based complexes. J Cell Sci 123, 3693-3702. 52. Zeng, X., Tamai, K., Doble, B., Li, S., Huang, H., Habas, R., Okamura, H., Woodgett, J. and He, X. (2005). A dual-kinase mechanism for Wnt co-receptor phosphorylation and activation. Nature 438, 873-877.

27


Accepted manuscript

Legends Figure 1: G3BP2 is a novel Dvl3-associated protein. A. Protein sequence of G3BP2. The peptide sequences of G3BP2 identified in Dvl3-based complexes are highlighted in blue. B. Schematic organization of G3BP2 and G3BP1 displaying a conserved NTF2 like domain, an RNA recognition motif , a glycine arginine rich motif and SH3 binding motifs. C. Cell lysates from F9 cells transfected with myc-G3BP2 were immunoprecipitated with either control mouse IgG or anti-Dvl3 antibodies followed by immunoblotting with anti-myc antibodies to detect G3BP2. D. F9 cells were transiently transfected with myc-G3BP2 either alone or together with HA-Dvl3-GFP2, followed by cell lysis and affinity pull-downs with anti-HA antibodies. Dvl3G3BP2 interaction was made visible by probing the blots with anti-myc antibodies. E. F9 cells were transiently transfected with either HA-Dvl1-GFP2, HA-Dvl2-GFP2,or HA-Dvl3-GFP2 alone or with myc-G3BP2 followed by cell lysis and affinity pull-downs with anti-HA antibodies. Dvl3-G3BP2 interaction was made visible by probing the blots with anti-myc antibodies. F. HEK 293 cells were transfected with myc-G3BP2 for 24 hours. The cells were then treated with Wnt3a (10 ng/ml) for indicated periods followed by cell lysis and immunopreciptation with anti-Dvl3 antibodies. Dvl3-G3BP2 interaction was made visible by probing the blots with anti-myc antibodies. Figure 2. G3BP2 regulates Wnt/β-catenin signaling. A. F9 cells were treated with either control siRNAs (100 nM) or siRNAs specific to mG3BP2 (100 nM) for 48 hours. G3BP2 knockdown efficiency was visualized by probing the blots with anti-G3BP2 antibodies. F9 cells were treated with either control siRNAs (100 nM) or siRNAs specific for mG3BP2 (100 nM) for 48 hours and the lysates were assayed either for cytosolic β-catenin levels (B) or Lef/Tcf-sensitive gene transcription (C.). Upper panel displays mean values ± S.E.M. obtained from three independent experiments; the lower panel displays representative blots. **, p< 0.01; versus control (- Wnt3a). ##, p< 0.01; versus control (+ Wnt3a). D. F9 cells were treated with either control siRNAs (100 nM) or siRNAs specific to mG3BP2 (100 nM) for 48 hours prior to stimulation with Wnt3a (20 ng/ml) for 4 days. Formation of primitive endoderm was assayed by immunocytochemistry (ICC) with anti-cytokeratin A antibody. Scale bar, 50 µM. E. F9 cells were treated with either control siRNAs (100 nM) or siRNAs specific to mG3BP2 (100 nM) for 48 hours and the β-catenin and cyclophilin A mRNA levels from total RNA were quantified using real-time PCR. The data represents normalized β-catenin mRNA to the cyclophilin A mRNA levels (mean values ± S.E.M.) from two independent experiments whose results were in high agreement. **, p< 0.01; versus control (control siRNA). F. Northwestern analysis of βcatenin mRNA interaction with G3BP1 or G3BP2. Myc-G3BP1 or Myc-G3BP2 immunoprecipitated from F9 cell lysates were separated on SDS-PAGE gels and transferred onto nitrocellulose membranes. Northwestern analysis was then performed using Dig-labeled βcatenin UTR. The upper panel represents northwestern blot while the lower panel display immunoblotting with anti-myc antibodies. Figure 3. PRMTs catalyze G3BP2 methylation. A. PRMT expression in F9 cells. Total RNA from F9 cells was isolated and RT-PCR was performed using mouse PRMT-specific primers. B. Lysates (1 mg) of F9 cells transfected with either pCMV-HA or HA-PRMTs were incubated with 1 µg of GST-G3BP2 and immunoprecipitated with anti-HA antibodies and protein-G resin. The immunoblots later were probed for G3BP2-PRMT interaction with anti-G3BP2 antibodies. The levels of input protein (GST-G3BP2) are also shown. C. F9 cells were transiently transfected 28


Accepted manuscript

with either pCMV-HA or HA-PRMTs. After 24 hours, the cells were lysed, and affinity pulldowns were performed with anti-HA specific antibodies. Immunoprecipitated PRMTs were used in an in vitro methylation reaction, in combination with GST-G3BP2 and [3H]-SAM. D. F9 cells were transiently transfected with either pCMV-myc or Myc-G3BP2. After 24 hours, the cells were treated with Wnt3a (10 ng/ml), followed by metabolic labeling with [3H]-L-methyl methionine. After 3 hours, the cells were lysed and affinity pull-downs with anti-myc specific antibodies were performed. The methylation status of G3BP2 was then revealed by SDS-PAGE followed by fluorography. After fluorography the blots were probed with anti-myc antibodies (lower panel). Figure 4. G3BP2 regulates LRP6 phosphorylation. A. F9 cells were treated with either control siRNA or G3BP2 specific siRNA for 24 hours, followed by another round of transfection with either control vector or LRP∆N plasmid. After 24 hours, the cells were stimulated without or with Wnt3a (10 ng/ml) for 7 hours and the lysates were assayed for Lef/Tcf-sensitive gene transcription. Mean values ± S.E.M. obtained from three independent experiments were displayed. *, p< 0.05; **, p< 0.01; versus control (- Wnt3a), ##, p< 0.01; versus control (+ Wnt3a). B,C. F9 cells were treated with either G3BP2 specific siRNAs (B) or G3BP1 specific siRNAs (C). After 48 hours, the cells were stimulated with Wnt3a (20 ng/ml) for 30 min followed by cell lysis. The lysates were later assayed for phospho-LRP6 levels. Upper panel displays mean values ± S.E.M. obtained from three independent experiments; the lower panel displays representative blots. **, p< 0.01; versus control (- Wnt3a). ##, p< 0.01; versus control (+ Wnt3a). D,E. F9 cells were treated with methyl transferase inhibitors, MTA (250 µM, D) or Adox (15 µM, E) for 16 hours prior to stimulation with Wnt3a (20 ng/ml) for 30 min. Cell lysates were later assayed for phospho-LRP6 levels. Upper panel displays mean values ± S.E.M. obtained from three independent experiments; the lower panel displays representative blots. **, p< 0.01; versus control (- Wnt3a). ##, p< 0.01; versus control (+ Wnt3a). F. F9 cells were transiently transfected with either pCMV-Myc, Myc-G3BP2 (WT) or its methylation-deficient mutants. After 24 hours, the cells were stimulated with Wnt3a (20 ng/ml) for 30 min, lysed and assayed for phosphoLRP6 levels. Upper panel displays mean values ± S.E.M. obtained from three independent experiments; the lower panel displays representative blots. #, p< 0.05; ##, p< 0.01; versus control (pCMV-Myc). G. HEK293 cells were transiently transfected with pcDNA3.1-HA-hGSK3β either alone or together with Myc-G3BP2 for 24 hours. After 24 hours, the cells were starved in DMEM medium without serum for 2 hours, followed by cell lysis. The cell lysates were later assayed for phospho-LRP6 levels. Upper panel displays mean values ± S.E.M. obtained from three independent experiments; the lower panel displays representative blots. **, p< 0.01; versus pCMV-Myc. #, p< 0.05; versus GSK3β alone. Figure 5. Arginine methylation of G3BP2 stimulates Dishevelled binding and regulates Wnt signaling. A. F9 cells were transfected with either pCMV-Myc, Myc-G3BP2 (WT) or its methylation-deficient mutants for 24 hours. Then cell lysis and affinity pull-downs were performed with anti-Dvl3antibodies. G3BP2-Dvl3 interaction was made visible by probing the blots with anti-myc antibodies. B. F9 cells were transiently transfected with pCMV-Myc, MycG3BP2 (WT) or its methylation-deficient mutants for 24 hours. After 24 hours, the cells were stimulated with Wnt3a (10 ng/ml) for 7 hours and the lysates were assayed for Lef/Tcf-sensitive gene transcription. C. SW480 cells were transfected with either pCMV-Myc, Myc-G3BP2 (WT) or its methylation deficient mutants together with 10 ng of M50 luciferase reporter, using Fugene transfection reagent (Promega). After 24 hours, the cells were lysed and the lysates were assayed 29

Figure 6. Schematic representation of G3BP2-mediated regulation of LRP6 phosphorylation and Wnt singaling. Wnt3a stimulation provokes methylation of G3BP2 by PRMTs, resulting in increased association of methylated G3BP2 by the Dvl3-based complexes. The Dvl3-based complexes (including methylated G3BP2 and kinases CKI and GSK3β) shuttles to the plasma membrane. LRP6 phosphorylation by GSK3β follows Axin recruitment to the membrane, turning the Wnt signal “ON”.


Accepted manuscript

for Lef/Tcf-sensitive gene transcription. Mean values ± S.E.M. obtained from three independent experiments were displayed. **, p< 0.01; versus control (pCMV-Myc), ##, p< 0.01; versus control (pCMV-Myc). D. Rescue experiments were performed in F9 cells by transfecting pCMV-Myc, siRNA-resistant wild-type or methylation-deficient (R432K, R452K, R468K) mutant of siRNAresistant G3BP2 or G3BP1 into G3BP2-depleted cells as described in the Materials and Methods. After 24 hours, the cells were stimulated with Wnt3a (25 ng/ml) for 7 hours and the lysates were assayed for Lef/Tcf-sensitive gene transcription. Mean values ± S.E.M. obtained from three independent experiments were displayed. ##, p< 0.01; versus control (Control siRNA + Wnt3a)

30


Accepted manuscript


Accepted manuscript


Accepted manuscript


Accepted manuscript


Accepted manuscript


Accepted manuscript


Accepted manuscript


Accepted manuscript

Table 1: List of primers Gene mG3BP2 sense mG3BP2 antisense mG3BP2 R418K sense mG3BP2 R418K antisense mG3BP2 R432K sense mG3BP2 R432K antisense mG3BP2 R438K sense mG3BP2 R438K antisense mG3BP2 R452K sense mG3BP2 R452K antisense mG3BP2 R457K sense mG3BP2 R457K antisense mG3BP2 R468K sense mG3BP2 R468K antisense mPRMT1 sense mPRMT1 antisense mPRMT2 sense mPRMT2 antisense mPRMT3 sense mPRMT3 antisense mPRMT4 sense mPRMT4 antisense mPRMT5 sense mPRMT5 antisense mPRMT6 sense mPRMT6 antisense mPRMT7 sense mPRMT7 antisense mPRMT8 sense mPRMT8 antisense

Primer sequence gaagatcttcatggttatggagaagcccag ataagaatgcggccgctcaacgacgctgtcctgtga gccagagagcgagaaaccaaaggtggtggcgatgaccgc gcggtcatcgccaccacctttggtttctcgctctctggc gatatcaggcgcaatgataagggtcctggtggtccacgt acgtggaccaccaggacccttatcattgcgcctgatatc cggggtcctggtggtccaaaaggaattgtgggtggtgga tccaccacccacaattccttttggaccaccaggaccccg atgcgtgatcgtgacggaaaagggccacctccacgaggt acctcgtggaggtggcccttttccgtcacgatcacgcat ggaagagggccacctccaaaaggtggcatgacacagaaa tttctgtgtcatgccaccttttggaggtggccctcttcc cagaaacttggttctggaaaaggaaccgggcaaatggaa ttccatttgcccggttccttttccagaaccaagtttctg cggaattccgatggcggcagccgaggccgc ggggtacctcagcgcatccggtagtcgg gaagatcttcatggaggcaccaggagaagg ataagaatgcggccgctcacctccagatcggaaaga ggggtaccatgtgttcgctagcggcggg ataagaatgcggccgctcactggagactgtaagtct gaagatcttcatggcagcggcggcagcgac ataagaatgcggccgcctaactcccatagtgcatgg gaagatcttcatggcggcgatggcagtcgg ataagaatgcggccgcctagaggccaatggtat gaagatcttcatgtcgctgagcaagaaaag ataagaatgcggccgctcagtcctccatggcaa gaagatcttcatgaaggtcttctgtggccg ataagaatgcggccgctcagctcaaggtgtctgcaa gaagatcttcatggcggagaatgcagtcga ataagaatgcggccgcctaacgcattttgtagtcat

JOURNAL OF CELL SCIENCE ACCEPTED MANUSCRIPT

Recommend Documents